Rats Fed Lifetime of GM Corn Grow Horrifying Tumors, new study.

BASHIR · 20-09-2012 04:50PM

YFlyer wrote: »

The paper mentions further studies will be carried out including glyphosate presence in rat tissues.

In conclusion, it was previously known that glyphosate consumption in water above authorized limits may provoke hepatic and kidney failures (EPA). The results of the study presented here clearly demonstrate that lower levels of complete agricultural glyphosate herbicide formulations, at concentrations well below officially set safety limits, induce severe hormone-dependent mammary, hepatic and kidney disturbances. Similarly, disruption of biosynthetic pathways that may result from overexpression of the EPSPS transgene in the GM NK603 maize can give rise to comparable pathologies that may be linked to abnormal or unbalanced phenolic acids metabolites, or related compounds. Other mutagenic and metabolic effects of the edible GMO cannot be excluded. This will be the subject of future studies, including transgene and glyphosate presence in rat tissues. Reproductive and multigenerational studies will also provide novel insights into these problems. This study represents the first detailed documentation of long-term deleterious effects arising from the consumption of a GM R-tolerant maize and of R, the most used herbicide worldwide.

So which is it that you are arguing against the use of GM crops , roundup or the use of both?

YFlyer · 20-09-2012 04:51PM

Ziphius wrote: »

Really? Well let's do a Chi Square test.

Tumor No Tumor

Control: 5 15

Treatment: 12 8
[/QUOTE]

Hi, where did you get these numbers on the paper?

Sorry just a wee bit tired so may have skipped over them.

marcsignal · 20-09-2012 04:55PM

Boombastic wrote: »

I don't like my food being messed with by scientists.

I agree. I don't trust GM food (although I'm probably eating it without even knowing).
Given the choice, I'd prefer the organic (not fcuked around with) alternative.

It's the so called 'official tests' that make me laugh. They plant the GM stuff outdoors, and tell us they are avoiding cross pollination by planting the GM stuff a few hundred yards away from regular crops.

Like, bees (that are mysteriously dying off as well) are not going to fly more than 300mts ???

and these people are supposed to be Scientists :rolleyes:

Ziphius · 20-09-2012 04:56PM

YFlyer wrote: »

Ziphius wrote: »

Really? Well let's do a Chi Square test.

Tumor No Tumor

Control: 5 15

Treatment: 12 8
[/QUOTE]

Hi, where did you get these numbers on the paper?

Sorry just a wee bit tired so may have skipped over them.

I posted it earlier.

Section 3

"After mean survival time had elapsed, any deaths that occurred
were considered to be largely due to aging. Before this period,
30% control males (three in total) and 20% females (only two) died
spontaneously, while up to 50% males and 70% females died in
some groups on diets containing the GM maize".

I assumed all groups were of 10 individuals.

Edit I added the number of females and males in each treatment group. I should have mentioned this.

Ziphius · 20-09-2012 05:02PM

marcsignal wrote: »

I agree. I don't trust GM food (although I'm probably eating it without even knowing).
Given the choice, I'd prefer the organic (not fcuked around with) alternative.

It's the so called 'official tests' that make me laugh. They plant the GM stuff outdoors, and tell us they are avoiding cross pollination by planting the GM stuff a few hundred yards away from regular crops.

Like, bees (that are mysteriously dying off as well) are not going to fly more than 300mts ???

and these people are supposed to be Scientists :rolleyes:

Those wily scientists and their research trials, eh? :rolleyes:

YFlyer · 20-09-2012 05:35PM

Ziphius wrote: »

Three treatment groups were used.

1). GM maize only
2.) GM maize and Round up herbicide
3.) Round up herbicide only.

This is clearly mentioned in the abstract. You are spreading misinformation YFlyer.

And the Control is mentioned in the Abstract.

What I put up is directly from the paper.

2.3. Animals and treatments

For each sex, one control group had access to plain water and standard diet from the closest isogenic non-transgenic maize control; six groups were fed with 11, 22 and 33% of GM NK603 maize either treated or not with R. The final three groups were fed with the control diet and had access to water supplemented with respectively 1.1 × 10−8% of R (0.1 ppb of R or 50 ng/L of glyphosate, the contaminating level of some regular tap waters), 0.09% of R (400 mg/kg, US MRL of glyphosate in some GM feed) and 0.5% of R (2.25 g/L, half of the minimal agricultural working dilution).

Shenshen · 20-09-2012 05:46PM

marcsignal wrote: »

I agree. I don't trust GM food (although I'm probably eating it without even knowing).
Given the choice, I'd prefer the organic (not fcuked around with) alternative.

It's the so called 'official tests' that make me laugh. They plant the GM stuff outdoors, and tell us they are avoiding cross pollination by planting the GM stuff a few hundred yards away from regular crops.

Like, bees (that are mysteriously dying off as well) are not going to fly more than 300mts ???

and these people are supposed to be Scientists :rolleyes:

Maize is wind pollinated...

Ziphius · 20-09-2012 05:59PM

YFlyer wrote: »

And the Control is mentioned in the Abstract.

What I put up is directly from the paper.

2.3. Animals and treatments

For each sex, one control group had access to plain water and standard diet from the closest isogenic non-transgenic maize control; six groups were fed with 11, 22 and 33% of GM NK603 maize either treated or not with R. The final three groups were fed with the control diet and had access to water supplemented with respectively 1.1 × 10−8% of R (0.1 ppb of R or 50 ng/L of glyphosate, the contaminating level of some regular tap waters), 0.09% of R (400 mg/kg, US MRL of glyphosate in some GM feed) and 0.5% of R (2.25 g/L, half of the minimal agricultural working dilution).

So you do acknowledge that Round up weed killer was given to the rates rats as part of the treatment?

SuperInfinity · 20-09-2012 06:35PM

marcsignal wrote: »

I agree. I don't trust GM food (although I'm probably eating it without even knowing).
Given the choice, I'd prefer the organic (not fcuked around with) alternative.

It's the so called 'official tests' that make me laugh. They plant the GM stuff outdoors, and tell us they are avoiding cross pollination by planting the GM stuff a few hundred yards away from regular crops.

Like, bees (that are mysteriously dying off as well) are not going to fly more than 300mts ???

and these people are supposed to be Scientists :rolleyes:

I saw a piece in the paper written by one of the study trial leaders claiming that in this specific instance that you could actually throw shovel-loads of the GM potatoes over normal potatoes and they couldn't cross-pollinate.

I'm sure he's probably right - probably. What if some very unlikely but possible DNA jump occurs, an occurrence that has from time to time been seen in nature. Once cross-pollination occurs, it could be the beginning of the end for normal spuds forever. I think this is the key thing about GM foods: once they cross-pollinate with normal foods, there may be no going back to the original food.

Even if this trial is safe, it paves the way for future trials and research, and they'll be using it as an example of how "nothing bad happened". And also I don't know who is checking all these measures supposedly put in place to prevent cross-pollination, it's a ridiculous enforcement issue. Only people in the industry would be "qualified" to do it. Again it's not this specific study, it's human error or something they didn't expect over hundreds of studies and later commercial usage.

I think humanity needs to put some kind of terrible stigma over GM foods, just like eugenics and atomic bombs, because they could be the irreversible end of natural food forever. Even if we could just delay them as much as possible, maybe it would be enough time to somehow download natural genomes that could be reproduced some time in the future.

1ZRed · 20-09-2012 06:36PM

Capt'n Midnight wrote: »

GM to produce human insulin \o/

It was produced by adding the human gene for insulin into the DNA of a certain strain of bacterium, the end result and product is insulin which is harvested. It was a massive break through in the treatment of diabetes and it was all down to the use of GMOs.

Capt'n Midnight wrote: »

the GMO in this case has been modified to resist herbicide so farmers can use more herbicide and hence monsato can sell more herbicide.

They can only add as much herbicide as is deemed healthy to human health, regardless of whether or not the plant has immunity to it or not. If they had free reign to use as much as they'd like, they would try to reach the maximum levels possible before they would damage the crop. Farmers don't care about what's healthy, they just want to turn the highest profit for themselves. There are regulations in place for a reason and that shouldn't change just because they are GM crops. But I get your point, worst case scenario, that would be a very big negative for GM crops.

Capt'n Midnight wrote: »

There is a lot of difference between using simple substance that already occur in nature and introducing foreign genes that can jump into other plants.

But that's how many species of crops/animals have been formed to date by cross breeding using similar methods. Much the same as you'd cross breed a horse for speed, strength, or endurance, you isolate a desired gene that gives the crop an advantage in its environment and you put that into its DNA. All you're doing is adding that little part to the organism and nature takes to over to build it. Completely natural. Much like selecting what eye colour you'd want your child to have.

And how might it jump so easily to another plants? They are not so easily interbred, they are diffrent species of organisms. With that logic, if I genetically engineered a dog how could I be sure the genes couldn't jump into another animal like a cat? Much the same as animals, just because they are plants, does not mean they can interbred so easily by that fact alone.
They have their own mechanisms, chromosome counts and reproductive strategies to avoid this. And even if it was so easily done, they would have all interbred by this stage naturally on their own anyway so that's not a valid worry.

Capt'n Midnight wrote: »

If weeds acquire herbicide resistance what then ?

It's not that simple and it would require the weeds to naturally cross breed with the crop which is very near impossible without human intervention.

Capt'n Midnight wrote: »

If organic crops acquire GM genes who will compensate the growers ?

If it was me that had to decide that, I wouldn't give them any sort of compensation. There isn't anything dangerous about them. They are just crops that have certain genes added to them. And considering the engineers know exactly what each gene does (because it's such a specific process) they are aware of the end factor and anything that might result from the final product.

GMOs are the future because they are the only way in which we can keep our global food supply high enough to support our already over populated planet. The fact that GMOs are in theory, healthier, better yielding and cheaper for the consumer is only a huge positive.

Pottler · 20-09-2012 06:53PM

Well, I've read through this, and I've made my mind up and it will not be changed for no-one. From now on, no feckin matter what, my kids are getting no more Round-up. That stops right here and now. I don't care how much they whinge, I am not for changing on this. Shocking altogether. Thanks for highlighting this pernicious issue OP, I had no idea it was bad for them. They'll just have to have milk on their corn-flakes from now on.

SuperInfinity · 20-09-2012 06:55PM

1ZRed wrote: »

But that's how many species of crops/animals have been formed to date by cross breeding using similar methods. Much the same as you'd cross breed a horse for speed, strength, or endurance, you isolate a desired gene that gives the crop an advantage in its environment and you put that into its DNA. All you're doing is adding that little part to the organism and nature takes to over to build it. Completely natural. Much like selecting what eye colour you'd want your child to have.

This is complete nonsense. "similar methods"? Farmers putting stuff into its DNA? DNA from insects doesn't go into oranges and fuse at the molecular level naturally like it can with GM technology. Get real. DNA from different kingdoms doesn't get spliced together in nature. Breeding is very little like evolution or large changes in genome. I suggest you get a clue about how breeding works before you write ignorant paragraphs like this. I've heard similar pro-GM arguments espoused before, but you're really getting into fairyland territory.

I am against human breeding or artificial selection, but no matter how much you breed a cat... to borrow an example from you... you will never obtain a dog. There are only certain defined limits you can breed animal characteristics to, then their entire system starts to become quite imbalanced and it doesn't go any further. This was one of the huge arguments against evolution years ago... you could rapidly breed characteristics a certain way, but they had a limit in how far they would go.

For example the largest breed of dog you will can get is the Great Dane, and even they have lots of walking problems. You'll never get a dog the size of an elephant because the way their basic DNA has been set down, everything would have to change completely. GM has none of that incredibly complex groundwork done, they have very little idea what they're doing: they just splice and dice genes in the hope some come out okay and they literally throw away at least 99/100 failures for one that appears to work.

Nobody has any idea of the subtle health impacts GM food has. Food isn't meant to just be "safe", it's meant to nourish and sustain us, it's meant to give us all the nutrients we need in the correct balance. Humans have evolved for millions of years with this food, and the foods have always stayed within their same kingdoms. It's not enough to consider GM food as "much the same, far as we can tell from these tests" if nothing bad goes wrong and call them "substantially equivalent" like they are trying to lobby for. That's hopeless nonsense, if that continues we can say goodbye to natural food forever.

Ziphius · 20-09-2012 07:37PM

SuperInfinity wrote: »

This is complete nonsense. "similar methods"? Farmers putting stuff into its DNA? DNA from insects doesn't go into oranges and fuse at the molecular level naturally like it can with GM technology. Get real. DNA from different kingdoms doesn't get spliced together in nature.

It's not. Genes do transfer between species in nature. E. chlorotica is a sea slug (animal) that obtained genes from algae (plant) enabling it to photosynthesize (reference). The human genome is full of genes which originated in viruses. HIV, for example, does this.

SuperInfinity wrote: »

Breeding is very little like evolution or large changes in genome. I suggest you get a clue about how breeding works before you write ignorant paragraphs like this. I've heard similar pro-GM arguments espoused before, but you're really getting into fairyland territory.

Actually it's the exact same. It's one of Darwin's key arguments in the Origin of Species. Artificial selection and natural selection are essentially the same mechanism. Desirable traits are being selected.

SuperInfinity wrote: »

I am against human breeding or artificial selection, but no matter how much you breed a cat... to borrow an example from you... you will never obtain a dog. There are only certain defined limits you can breed animal characteristics to, then their entire system starts to become quite imbalanced and it doesn't go any further. This was one of the huge arguments against evolution years ago... you could rapidly breed characteristics a certain way, but they had a limit in how far they would go.

You're against human breeding and artificial selection? You do realize this is where are food comes from?

SuperInfinity wrote: »

For example the largest breed of dog you will can get is the Great Dane, and even they have lots of walking problems. You'll never get a dog the size of an elephant because the way their basic DNA has been set down, everything would have to change completely.

Everything would not have to change completely. Humans and chimps have, what?, 99% of all there genes in common. Minor changes in key developmental genes can lead to vastly different phenotypes.

SuperInfinity wrote: »

GM has none of that incredibly complex groundwork done, they have very little idea what they're doing: they just splice and dice genes in the hope some come out okay and they literally throw away at least 99/100 failures for one that appears to work.

Wrong. You're actually thinking about radiation breeding.Something like 99% of all commercial peppermint plants originate from plants created by irradiated seeds and crossing your fingers. I'm sure it's fine though, no GM here :rolleyes:

SuperInfinity wrote: »

Nobody has any idea of the subtle health impacts GM food has. Food isn't meant to just be "safe", it's meant to nourish and sustain us, it's meant to give us all the nutrients we need in the correct balance. Humans have evolved for millions of years with this food, and the foods have always stayed within their same kingdoms. It's not enough to consider GM food as "much the same, far as we can tell from these tests" if nothing bad goes wrong and call them "substantially equivalent" like they are trying to lobby for. That's hopeless nonsense, if that continues we can say goodbye to natural food forever.

So you're against GM foods because they're unhealthy or not nutritious? GM foods have been in the human food supply for over two decades now without any damaging health effects.

I recommend you educate yourself before you feel entitled to castigate another poster.

steddyeddy · 20-09-2012 07:52PM

Run_to_da_hills wrote: »

I wasn't too long ago when we had protests in this country concerning the Government permitting the cultivation GM spuds which is no different o poisoning the population with fluoride water. New studies by french scientists reveal large tumors have developed on rats that have been fed on GM corn.

God help our kids if Governments are continually allowed to fcuk about with nature.

http://www.pakalertpress.com/2012/09/20/shocking-findings-in-new-gmo-study-rats-fed-lifetime-of-gm-corn-grow-horrifying-tumors/

Again can people who are against gm food also against insulin for diabetic patients? Are they also against potential gene therapy to cure diseases ranging from huntingtons disease to cancer. Because if your not against the above its very hypocritical.

steddyeddy · 20-09-2012 07:56PM

Ziphius wrote: »

It's not. Genes do transfer between species in nature. E. chlorotica is a sea slug (animal) that obtained genes from algae (plant) enabling it to photosynthesize (reference). The human genome is full of genes which originated in viruses. HIV, for example, does this.

Actually it's the exact same. It's one of Darwin's key arguments in the Origin of Species. Artificial selection and natural selection are essentially the same mechanism. Desirable traits are being selected.

You're against human breeding and artificial selection? You do realize this is where are food comes from?

Everything would not have to change completely. Humans and chimps have, what?, 99% of all there genes in common. Minor changes in key developmental genes can lead to vastly different phenotypes.

Wrong. You're actually thinking about radiation breeding.Something like 99% of all commercial peppermint plants originate from plants created by irradiated seeds and crossing your fingers. I'm sure it's fine though, no GM here :rolleyes:

So you're against GM foods because they're unhealthy or not nutritious? GM foods have been in the human food supply for over two decades now without any damaging health effects.

I recommend you educate yourself before you feel entitled to castigate another poster.

That sea slug is one of my favouraite animals. I think research into that could give us insight into new gene therapies.

1ZRed · 20-09-2012 08:03PM

SuperInfinity wrote: »

This is complete nonsense. "similar methods"? Farmers putting stuff into its DNA? DNA from insects doesn't go into oranges and fuse at the molecular level naturally like it can with GM technology. Get real. DNA from different kingdoms doesn't get spliced together in nature. Breeding is very little like evolution or large changes in genome. I suggest you get a clue about how breeding works before you write ignorant paragraphs like this. I've heard similar pro-GM arguments espoused before, but you're really getting into fairyland territory.

My point is, you want your trait, you get your trait. Whether that's by cross breeding or genetic engineering. It's the same principle of extracting a desired characteristic from one organism and combining it with another.

It's not as if you're necessarily taking something toxic out of an organism. It's just a natural DNA segment from one animal into another. If the first has been deemed safe and it's end product known, how could it be harmful in another organism?

That's like genetically modifying a cow to be black in colour instead of brown using the corresponding gene for that. Tell me, would this cow now have any sort of negative health implications because of this?

And I'll give you an example, GM rice was used in China to help overcome the high levels of vitamin A deficiency there. Using a gene extracted from the daffodil, it was spliced into the rice so that the rice could now produce vitamin A. And that's how Golden Rice came about. No negative health implications have been observed what so ever.

SuperInfinity wrote: »

Nobody has any idea of the subtle health impacts GM food has. Food isn't meant to just be "safe", it's meant to nourish and sustain us, it's meant to give us all the nutrients we need in the correct balance. Humans have evolved for millions of years with this food, and the foods have always stayed within their same kingdoms. It's not enough to consider GM food as "much the same, far as we can tell from these tests" if nothing bad goes wrong and call them "substantially equivalent" like they are trying to lobby for. That's hopeless nonsense, if that continues we can say goodbye to natural food forever.

And who's to say that the artificial and chemical alternatives are any safer or healthier? As a matter of fact because of the use artificial fertilisers and current intensive farming, the nutritional value as decreed hugely over the last 70-80 years. In cases, up to and over half of the nutritional value is lost in certain crops and that has had nothing to do with GM food sources.
And speaking about what's healthier, there has been a strong link to many cancers and other diseases brought about by these harsh chemicals.

You say I have no clue about breeding but I don't think you have any sort of clue as to how specific a gene is in an organism and that it only has 1 purpose. It doesn't create a whole set of problems because its not how they work by natural law and that's unchanging. The nutritional loss might only arise if the engineers begin to change that side of things. If they leave it alone, nothing will happen. If anything, GMOs have the potential to regain much of the goodness that has been lost over the years because of intensive farming and cultivating.
The "natural" argument doesn't come into play anymore because we already use many artificial and synthetic chemicals already in our food production, whether its inorganic or organic, so that's unnatural right there and we haven't evolved to consume many of these substances.

SuperInfinity · 20-09-2012 08:09PM

Ziphius wrote: »

It's not. Genes do transfer between species in nature. E. chlorotica is a sea slug (animal) that obtained genes from algae (plant) enabling it to photosynthesize (reference).

They then turned their attention to the sea slug's own DNA and found one of the vital algal genes was present. Its sequence was identical to the algal version, indicating that the slug had probably stolen the gene from its food.

One possibility is that, as the algae are processed in the sea slug's gut, the gene is taken into its cells as along with the chloroplasts. The genes are then incorporated into the sea slug's own DNA, allowing the animal to produce the necessary proteins for the stolen chloroplasts to continue working.

Another explanation is that a virus found in the sea slug carries the DNA from the algal cells to the sea slug's cells. However, Rumpho says her team does not have any evidence for this yet.

In another surprising development, the researchers found the algal gene in E. chlorotica's sex cells, meaning the ability to maintain functional chloroplasts could be passed to the next generation.

They are not sure what's going on. This is a very poor example of inter-kingdom gene transfer between higher organisms.

Ziphius wrote: »

The human genome is full of genes which originated in viruses. HIV, for example, does this.

Eh? Viruses are separate to all other life, they evolved after their hosts. Of course viruses are the way genes are generally transferred. HIV was a very rare example of inter-species transfer... between a human and another primate. Where exactly did I say that inter-species gene transfer didn't take place? I said inter-kingdom, didn't I.

Ziphius wrote: »

Actually it's the exact same. It's one of Darwin's key arguments in the Origin of Species. Artificial selection and natural selection are essentially the same mechanism. Desirable traits are being selected.

They are NOT "essentially the same mechanism". Darwin goes over and over the point since as I already stated, this was a huge point of contention against the evolution of species.

Ziphius wrote: »

You're against human breeding and artificial selection? You do realize this is where are food comes from?

It is not "where food comes from", we have co-evolved with food for millions of years and it would be perfect if it were left alone. Any artificial selection simply damages it by making it less suitable for how we were evolved. If you don't believe that then you don't believe in evolution and have zero understanding of it.

Ziphius wrote: »

Everything would not have to change completely. Humans and chimps have, what?, 99% of all there genes in common. Minor changes in key developmental genes can lead to vastly different phenotypes.

Wrong. You're actually thinking about radiation breeding.Something like 99% of all commercial peppermint plants originate from plants created by irradiated seeds and crossing your fingers. I'm sure it's fine though, no GM here :rolleyes:

yeah right, like those are meant to be points. I'm not even going to dignify these comments with responses.

Ziphius wrote: »

So you're against GM foods because they're unhealthy or not nutritious? GM foods have been in the human food supply for over two decades now without any damaging health effects.

I already stated that it's the fact that they don't nourish us, not that they will cause easily-identifiable health problems in humans. It would be extremely hard, practically impossible to try to pinpoint long-term health problems or risks to GM foods like that, even if they doubled cancer risk.

steddyeddy · 20-09-2012 08:11PM

Messing with nature has gone on for thousands of years. Look at the dog, cat, cow, horse, chicken and pigeon. In terms of crops look at crops! Do you think they look anything like the wild type.

strobe · 20-09-2012 08:27PM

Ziphius wrote: »

I'm getting my information from New Scientist. A good article here.

"Some other test groups, however, were healthier than the controls."

Boffins create super corn!!

Scientists have invented a new strain of corn that increases the health of rats studies have shown. Could this be the much sought after 'fountain of youth' as seen in smash hit movie staring super hunk Johnny Depp (interview page 16) Pirates of the Caribbean: On Stranger Tides, we asked curvy TV darling Vanessa Feltz...

SuperInfinity · 20-09-2012 08:28PM

1ZRed wrote: »

My point is, you want your trait, you get your trait. Whether that's by cross breeding or genetic engineering. It's the same principle of extracting a desired characteristic from one organism and combining it with another.

That's like saying whether you travel by bike or by plane it's all pretty much the same idea. Sure one is going hundreds of times faster, is up in the air, and has hundreds of other differences that make it completely different, the fundamental principle of travelling is the same and therefore it should be treated similarly.

1ZRed wrote: »

It's not as if you're necessarily taking something toxic out of an organism. It's just a natural DNA segment from one animal into another. If the first has been deemed safe and it's end product known, how could it be harmful in another organism?

ah now really IZred. You can't just chop and swap and switch DNA sequences like this, that's not how it works. That would be like saying: "if this part of a certain piece of software works for that software, then how could it not be safe to simply copy and paste it inside the software for another?"

Naturally the organism would reject any types of DNA that someone tries to insert into it. It's only by implementing restriction enzymes to inhibit the candidate's natural defences against this invader that the virus is able to take root. Once the virus takes root, it will divide and the new DNA can get inserted. It's correct to state it's infecting the plant with this virus and creating a tumour.

1ZRed wrote: »

That's like genetically modifying a cow to be black in colour instead of brown using the corresponding gene for that. Tell me, would this cow now have any sort of negative health implications because of this?

There's no single gene you can simply switch on and off like that for black instead of brown. Personally I would be against any such modifications as a policy, but sure, no harm would probably come of that wholly theoretical situation. However just remember that organisms have evolved different coloured coats for sometimes really good reasons.

1ZRed wrote: »

And I'll give you an example, GM rice was used in China to help overcome the high levels of vitamin A deficiency there. Using a gene extracted from the daffodil, it was spliced into the rice so that the rice could now produce vitamin A. And that's how Golden Rice came about. No negative health implications have been observed what so ever.

It would be a lot safer, easier and cheaper to simply give them extra vitamin A as a supplement. Food is not the same as a bunch of multivitamin pills, everything in it is balanced in nature.

Just because "no negative health implications have been observed" doesn't mean they didn't occur. If some of the kids had/have headaches sometimes but didn't really complain about them, who's ever going to "observe" that? You can't rely on anyone being able to pick up stuff like that.

1ZRed wrote: »

And who's to say that the artificial and chemical alternatives are any safer or healthier? As a matter of fact because of the use artificial fertilisers and current intensive farming, the nutritional value as decreed hugely over the last 70-80 years. In cases, up to and over half of the nutritional value is lost in certain crops and that has had nothing to do with GM food sources.
And speaking about what's healthier, there has been a strong link to many cancers and other diseases brought about by these harsh chemicals.

You have a point, however the changes GM foods could make to food would be irreversible. With chemicals, you can at least stop using them if you really want to at the end of the day. You're not imposing it on the rest of human-kind for the rest of human existence, and all other animals and life also.

1ZRed wrote: »

You say I have no clue about breeding but I don't think you have any sort of clue as to how specific a gene is in an organism and that it only has 1 purpose.

Excuse me but that's not true at all. Only in extremely rare cases does one gene or group of genes appear to directly relate to one characteristic and no other. Usually you don't have any easy inheritance rules even (nevermind identifiable genes) like in Mendel's peas where they can be mapped very clearly, there is usually a whole cluster of genes together and sometimes even on different chromosomes affecting each other.

Even if there were, the GMO scientists cannot say: "ok, this is gene 482871098928, now let's change that to hexademical 2A to change the colour to a nice blue". They can't be that specific about genes, all they do is infect an organism with a sequence that appears to do something in another organism and hope that it works in this one. It's simple Russian Roulette, and they will readily admit that the vast, vast majority of the attempted injections are failures.

1ZRed wrote: »

It doesn't create a whole set of problems because its not how they work by natural law and that's unchanging.

Yes it does, that's the whole point. That's the whole problem.

1ZRed wrote: »

The "natural" argument doesn't come into play anymore because we already use many artificial and synthetic chemicals already in our food production, whether its inorganic or organic, so that's unnatural right there and we haven't evolved to consume many of these substances.

But DNA is self-replicating, there is no going back and not using it if we don't like the results.

steddyeddy · 20-09-2012 08:31PM

SuperInfinity wrote: »

That's like saying whether you travel by bike or by plane it's all pretty much the same idea. Sure one is going hundreds of times faster, is up in the air, and has hundreds of other differences that make it completely different, the fundamental principle of travelling is the same and therefore it should be treated similarly.

ah now really IZred. You can't just chop and swap and switch DNA sequences like this, that's not how it works. That would be like saying: "if this part of a certain piece of software works for that software, then how could it not be safe to simply copy and paste it inside the software for another?"

Naturally the organism would reject any types of DNA that someone tries to insert into it. It's only by implementing restriction enzymes to inhibit the candidate's natural defences against this invader that the virus is able to take root. Once the virus takes root, it will divide and the new DNA can get inserted. It's correct to state it's infecting the plant with this virus and creating a tumour.

There's no single gene you can simply switch on and off like that for black instead of brown. Personally I would be against any such modifications as a policy, but sure, no harm would probably come of that wholly theoretical situation. However just remember that organisms have evolved different coloured coats for sometimes really good reasons.

It would be a lot safer, easier and cheaper to simply give them extra vitamin A as a supplement. Food is not the same as a bunch of multivitamin pills, everything in it is balanced in nature.

Just because "no negative health implications have been observed" doesn't mean they didn't occur. If some of the kids had/have headaches sometimes but didn't really complain about them, who's ever going to "observe" that? You can't rely on anyone being able to pick up stuff like that.

You have a point, however the changes GM foods could make to food would be irreversible. With chemicals, you can at least stop using them if you really want to at the end of the day. You're not imposing it on the rest of human-kind for the rest of human existence, and all other animals and life also.

Excuse me but that's not true at all. Only in extremely rare cases does one gene or group of genes appear to directly relate to one characteristic and no other. Usually you don't have genes like in Mendel's peas where they can be mapped very clearly, there is usually a whole cluster of genes together and sometimes even on different chromosomes affecting each other.

Besides, the GMO scientists cannot say: "ok, this is gene 482871098928, now let's change that to hexademical 2A". They can't be that specific about genes, all they do is infect an organism with a sequence that appears to do something in another organism and hope that it works in this one. It's simple Russian Roulette, and they will readily admit that the vast, vast majority of the attempted injections are failures.

Yes it does, that's the whole point. That's the whole problem.

But DNA is self-replicating, there is no going back and not using it if we don't like the results.

Again I take it your also against the use of insulin (gm) and gene therapy?

steddyeddy · 20-09-2012 08:40PM

In any conversation about gm no one has answered the above question convincingly. So to be honest the only conclusion I can come to is you all just hate gm for the sake of it. Evidence or science matters as much to gm haters as creationists.

marcsignal · 20-09-2012 08:43PM

Ziphius wrote: »

Those wily scientists and their research trials, eh? :rolleyes:

I just think we are being railroaded into this, and where there is big money to be made, you can be sure, public safety will come a poor second, imo.

Shenshen wrote: »

Maize is wind pollinated...

Ok, but do you think wind wouldn't carry pollen a distance over 300mts ?
How can they possibly predict weather conditions over the growth period of the plant with anything near certainty ?

It's the involvement of big corporations in all this, and their real motives, that worries me.

SuperInfinity · 20-09-2012 08:54PM

steddyeddy wrote: »

Again I take it your also against the use of insulin (gm) and gene therapy?

I'm not particularly against the use of insulin gotten by gm so long as it's completely contained and there's no chance of escape. I'm not against that at all.

I'm greatly against gene therapy, especially ones that affect germline cells. If you do that then you are literally turning into something else. Any children you have won't really be your children. And it will set a course for humans were normal individuals will be pressurized into getting gene therapy just to "keep up", a cut-throat race to the bottom. And what will come out after a while will no longer be human because it will be changed so much, and no end will be in sight. At first they might look like the german eugenics ideals, later they won't be human at all. It'll turn sport into a mockery, normal humans like you and I or any of our descendants wouldn't have a snowball's chance in hell in such a world.

steddyeddy · 20-09-2012 08:56PM

SuperInfinity wrote: »

I'm not particularly against the use of insulin gotten by gm so long as it's completely contained and there's no chance of escape. I'm not against that at all.

I'm greatly against gene therapy, especially ones that affect germline cells. If you do that then you are literally turning into something else. Any children you have won't really be your children. And it will set a course for humans were normal individuals will be pressurized into getting gene therapy just to "keep up", a cut-throat race to the bottom. And what will come out after a while will no longer be human because it will be changed so much, and no end will be in sight. At first they might look like the german eugenics ideals, later they won't be human at all.

Fair play for answering.

Shenshen · 20-09-2012 08:58PM

marcsignal wrote: »

Ok, but do you think wind wouldn't carry pollen a distance over 300mts ?
How can they possibly predict weather conditions over the growth period of the plant with anything near certainty ?

It's the involvement of big corporations in all this, and their real motives, that worries me.

All it takes is a few winbreaks, I should think. If the GM maize can even be pollinated, as far as I know Monsanto crops will be sterile as a matter of course.

With big companies, the real motive is money.

Ziphius · 20-09-2012 09:09PM

SuperInfinity wrote: »

They are not sure what's going on. This is a very poor example of inter-kingdom gene transfer between higher organisms.

Did a creationist teach you how to quote mine or is it just a gift? The fact is an animal contains an algal gene in its genome. That they is no evidence it was transferred there by a virus does not refute this.

SuperInfinity wrote: »

Eh? Viruses are separate to all other life, they evolved after their hosts. Of course viruses are the way genes are generally transferred. HIV was a very rare example of inter-species transfer... between a human and another primate. Where exactly did I say that inter-species gene transfer didn't take place? I said inter-kingdom, didn't I.

Viruses are not the (main) way genes a transferred. They are passed from parent to child. Why stop at inter-kingdom transfer? Why not inter-domain? Agrobacterium tumefaciens
is a bacteria that has the fascinating habit of transferring it's genes into plants. Amazing, no?

SuperInfinity wrote: »

They are NOT "essentially the same mechanism". Darwin goes over and over the point since as I already stated, this was a huge point of contention against the evolution of species.

What? You cannot be serious? Explain to me how they differ. Explain to me how "this was a huge point of contention against the evolution of species".

SuperInfinity wrote: »

It is not "where food comes from", we have co-evolved with food for millions of years and it would be perfect if it were left alone.

Really? And there was me thinking agriculture was only a few thousand years old.:rolleyes:

SuperInfinity wrote: »

Any artificial selection simply damages it by making it less suitable for how we were evolved. If you don't believe that then you don't believe in evolution and have zero understanding of it.

If this is your wacky concept of evolution I have no desire to "believe" it nor understand. I'll stick to the science of evolution, which is something I happen to know quite a bit about.

SuperInfinity wrote: »

yeah right, like those are meant to be points. I'm not even going to dignify these comments with responses.

Wow, you sure showed me.

SuperInfinity wrote: »

I already stated that it's the fact that they don't nourish us, not that they will cause easily-identifiable health problems in humans. It would be extremely hard, practically impossible to try to pinpoint long-term health problems or risks to GM foods like that, even if they doubled cancer risk.

Evidence?

Ziphius · 20-09-2012 09:14PM

SuperInfinity wrote: »

I think humanity needs to put some kind of terrible stigma over GM foods, just like eugenics and atomic bombs, because they could be the irreversible end of natural food forever. Even if we could just delay them as much as possible, maybe it would be enough time to somehow download natural genomes that could be reproduced some time in the future.

I'm sure the millions of children in the developing world blinded because they can't get GM golden rice will be ever so happy that we, affluent westerners, can live in world without roundup resistant maize.:rolleyes:

1ZRed · 20-09-2012 09:35PM

SuperInfinity wrote: »

ah now really IZred. You can't just chop and swap and switch DNA sequences like this, that's not how it works. That would be like saying: "if this part of a certain piece of software works for that software, then how could it not be safe to simply copy and paste it inside the software for another?"

Yes you can! That's what restriction enzymes are used for. Your genes are made up of 4 base pairs; Adenine, Guanine, Cytosine and Thymine.
Once you isolate your gene on a chromosome, lets say it's in the pattern ATTCGATGGCATTAACGATCAT and the bolded sequence is your gene, you fashion a restriction enzyme to cut everywhere there is a "CGAT" pattern so you go from ATTCGAT*GGCATTAA*CGATCAT = GGCATTAA

Now you have your specific gene with no mess. Genetic engineering is just that precise.
And yes you can incorporate that gene onto an appropriate section on the DNA plasmid of a bacterium for example, and it will code for the production of the protein which that gene is in control of.
This has been done on mice where the natural bioluminescence found in deep sea jelly fish has been brought into the DNA of mice with success. There's hope that this will allow scientists to monitor the effectiveness of drug treatments and the progression of cancer easier because the bioluminescence allows for physical changes to be seen faster. The health of the mouse would correspond to its luminescence.

SuperInfinity wrote: »

Naturally the organism would reject any types of DNA that someone tries to insert into it. It's only by implementing restriction enzymes to inhibit the candidate's natural defences against this invader that the virus is able to take root. Once the virus takes root, it will divide and the new DNA can get inserted. It's correct to state it's infecting the plant with this virus and creating a tumour.

Nope. If you can slot the DNA section in and it lines up perfectly (A=T , C=T) then the organism connot reject it. DNA is the control centre of the organism, it is not consious of it. The gene tries to carry out it's function because that's all it knows to do. If it doesn't work, it doesn't work but that's not because it has been rejected, it's impossible because nature had no such idea humans would go altering DNA so it has no defence once the DNA syncs up perfectly to the rest of the DNA sequence. Now, it does have repairing proteins but it cannot tell what "foreign" DNA is. They are not like antibodies so it doesn't destroy anything.

SuperInfinity wrote: »

However just remember that organisms have evolved different coloured coats for sometimes really good reasons.

If you are only taking about coloured coats then that is nothing but an environmental counter against predation. But if you're taking about poisons, then that is another factor altogether and takes the combination of many genes to make the toxins, make the visual warning, etc. Again, we'd know what those genes do anyway so why would we want such genes?

SuperInfinity wrote: »

It would be a lot safer, easier and cheaper to simply give them extra vitamin A as a supplement. Food is not the same as a bunch of multivitamin pills, everything in it is balanced in nature.

In an impoverished country of a billion people who's main food source is rice? You don't see how that would be so inefficient and ineffective. Golden rice has saved the lives of billions, that wouldn't have been achieved in any cheap or easy way by just giving them a vitamin A supplement. That's is a very ill thought out comment.

SuperInfinity wrote: »

Just because "no negative health implications have been observed" doesn't mean they didn't occur. If some of the kids had/have headaches sometimes but didn't really complain about them, who's ever going to "observe" that? You can't rely on anyone being able to pick up stuff like that.

And look at the known links to cancer from pesticides. You are making baseless and factless accusations about GM products when there is no substantial or credible evidence to support "lack of safety". We know how toxic pesticides and fungicides are and I find it so ironic that people accuse GMOs of being more dangerous based on nothing.

SuperInfinity wrote: »

You have a point, however the changes GM foods could make to food would be irreversible. With chemicals, you can at least stop using them if you really want to at the end of the day. You're not imposing it on the rest of human-kind for the rest of human existence, and all other animals and life also.

Cell DNA mutations and damage that arise from consuming these chemicals are forever with us too.

SuperInfinity wrote: »

Excuse me but that's not true at all. Only in extremely rare cases does one gene or group of genes appear to directly relate to one characteristic and no other. Usually you don't have any easy inheritance rules even (nevermind identifiable genes) like in Mendel's peas where they can be mapped very clearly, there is usually a whole cluster of genes together and sometimes even on different chromosomes affecting each other.

Nope. You're confusing chromosomes to genes. Many genes are on the same chromosome but only one gene can do one task. You're thinking about meiosis and the fusion of two sex cells which bring two chromosomes together, genes and all. I'm not taking about that. I'm taking about isolating the specific genes which is what is done in GE.

SuperInfinity wrote: »

Even if there were, the GMO scientists cannot say: "ok, this is gene 482871098928, now let's change that to hexademical 2A to change the colour to a nice blue". They can't be that specific about genes, all they do is infect an organism with a sequence that appears to do something in another organism and hope that it works in this one. It's simple Russian Roulette, and they will readily admit that the vast, vast majority of the attempted injections are failures.

That's the WHOLE basis of science! Trail and error again and again until it works. That's how everything from medicine to technology progresses, even your organic fertilisers!

SuperInfinity wrote: »

But DNA is self-replicating, there is no going back and not using it if we don't like the results.

Yeah, and with all the drugs, chemicals, radio waves, radiation and everything else that isn't "natural" that we expose ourselves to, we are constantly changing our DNA. Wake up. The fear behind GMOs is unwarranted and you can see is all based on false information and no real understanding of the processes of it.
Give me a nice long thorough and accurate scientific break down of the dangers involved and I'll shut up, until then, keep an open mind and stop spreading fear with no evidence or reason.

SuperInfinity · 20-09-2012 09:44PM

1ZRed you make me laugh. Pulling out this basic stuff you probably read online recently and thinking that it makes a point in your case, I've posted all relevant things I already wanted to post and do not find it worthwhile to post anymore. Good day.

Rats Fed Lifetime of GM Corn Grow Horrifying Tumors, new study.

Comments