Advertisement
Help Keep Boards Alive. Support us by going ad free today. See here: https://subscriptions.boards.ie/.
https://www.boards.ie/group/1878-subscribers-forum

Private Group for paid up members of Boards.ie. Join the club.
Hi all, please see this major site announcement: https://www.boards.ie/discussion/2058427594/boards-ie-2026

The Origin of Specious Nonsense. Twelve years on. Still going. Answer soon.

18182848687101

Comments

  • Registered Users, Registered Users 2 Posts: 1,594 ✭✭✭oldrnwisr


    J C wrote: »
    In general, living CFSI has relatively low Kolmogorov complexity due to the limited combinatorial space for useful biomolecules and the genetic CFSI that produces them.
    Mutagenesis will certainly increase its Kolmogorov complexity but at a very high cost in functionality and specificity ... rapidly reaching the point of complete disfunctionality and death.

    OK, before we begin let's clear something up. There's no such thing as "complex functional specified information". The concept originally outlined by Dembski is based on the idea of specified complexity which existed in biology before Dembski ever put pen to paper, as it were. Dembski's work is often quoted as complex specified information but adding the word functional into the mix doesn't help your case any, it's just a meaningless term. Apart from two references on a blog and a single forum post the only references on the internet to "complex functional specified information" come from you. Not even other "creation scientists" use the term CFSI. Your problem is that CSI has been so comprehensively torn apart not just on this thread but by a number of actual scientists that you feel that tossing the word functional into the mix is somehow going to negate the fatal flaws in CSI. It isn't.

    Now, let's talk specified complexity, Kolmogorov complexity and functionality.

    We've already seen that Dembski uses low Kolmogorov complexity as the basis for his idea of complex specified information. However, his total ignorance of biology undermines the concept from the get go. As I've already described low Kolmogorov complexity allows for the information content of a message to be transmitted in an abbreviated form. So if you want to send the following 32 bit string:

    ABABABABABABABABABABABABABABABAB

    you can just send "AB 16 times" which can take up just 9 bits of information. Dembski's idea is that information with specified complexity i.e. something that is functionally useful for an organism would have a DNA sequence which has low Kolmogorov complexity. He further argues, just as you have done above that mutation increases Kolmogorov complexity at the cost of function. He, and you, are fractally wrong.

    Firstly, let's consider a single mutation in the above sequence:

    ABABABCBABABABABABABABABABABABAB

    Now, we have changed the sequence by just a single letter but we have significantly increased the Kolmogorov complexity. But what does this do to the function of the sequence? Well, in this hypothetical example, nothing because it's just a simplified example, but next let's look at a real example.

    On the short arm of chromosome 4 there exists a gene with the following structure:

    CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

    Now, using Dembski's argument this gene is an example of complex specified information since a) it has low Kolmogorov complexity and b) it has a specific function, i.e. it codes for the protein huntingtin. Dembski's idea is that a mutation in this gene would lead to increased Kolmogorov complexity. Does it? Well, as it turns out no. The structure above is an example of the gene sequence in a healthy adult. Now let's look at two mutated sequences:

    1.
    CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAG

    2.
    CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAGCAGCAGCAGCAG

    The healthy version of the gene contains repeats of the codon CAG with normally between 6 and 35 repeats. The first mutated example above contains 36 repeats while the second example contains 40 repeats. In the first example, the 36 repeats cause the huntingtin protein to stop working normally and it no longer interacts with other proteins as it normally would. In the second mutated example, a modified huntingtin protein is produced which fragments itself and draws other proteins into lumps forming neuronal intranuclear inclusions which causes the person with the mutated gene to develop Huntington's disease. So we have three examples above of DNA sequences with normal function, no function and harmful function. What about the Kolmogorov complexity. Well, since the sequence is composed of repeats of the same codon, the Kolmogorov complexity for all three sequences is exactly the same, contrary to what Dembski predicts.

    There are two more problems with Dembski's CSI idea, one of which we've already touched on and one we haven't.

    Firstly, mutation types. In post 2617 I explained why Dembski's CSI idea fails because he believes that mutation happens only through indels (insertions or deletions) of nucleotides or frameshift mutations. It doesn't and mutations like gene duplication or aneuploidy completely obviate Dembski's argument about increasing complexity destroying functionality. Furthermore, we have evidence of novel functionality being acquired through mutation contrary to what Dembski claims.

    Emergence of nylon oligomer degradation enzymes in Pseudomonas aeruginosa PAO through experimental evolution.

    Evolution of a regulated operon in the laboratory


    Evolution of a new enzymatic function by recombination within a gene

    These are just 3 examples out of over 3000 papers which detail the acquisition of novel function through gene duplication or mutation types other than those considered by Dembski.

    Now, secondly, for the big elephant in the room, redundancy. Dembski (and other creationists) argue the idea that a protein sequence needs to be a certain way, that if you change one letter out of a 100 amino acid sequence then you're going to **** everything up and nothing's going to work anymore. Trouble is he's dead wrong. Just to underscore this problem here's an excerpt of a creationist trying to prove design using Shannon information:

    "Complex specified information is a specified subset of Shannon information. That means that complex specified information is Shannon information of a specified nature, ie with meaning and/ or function, and with a specified complexity.

    Shannon's tells us that since there are 4 possible nucleotides, 4 = 2^2 = 2 bits of information per nucleotide. Also there are 64 different coding codons, 64 = 2^6 = 6 bits of information per amino acid, which, is the same as the three nucleotides it was translated from.

    Take that and for example a 100 amino acid long functioning protein- a protein that cannot tolerate any variation, which means it is tightly specified and just do the math 100 x 6 + 6 (stop) = 606 bits of specified information- minimum, to get that protein. That means CSI is present and design is strongly supported.


    Now if any sequence of those 100 amino acids can produce that protein then it isn't specified. IOW if every possible combo produced the same resulting protein, I would say that would put a hurt on the design inference."


    I have highlighted the portion of the post where the creationist argument unravels. He fails to take into account redundancy.

    Firstly, he mentions that there are 64 possible codons which, irrelevantly, is equal to 2^6. However, what he fails to mention is that these 64 codons produce just 20 amino acids as shown in the table below:

    image_preview


    There is a high degree of structural redundancy among codons such that, for example, arginine can be produced by any of the following combinations: CGT, CGC, CGA, CGG, AGA, AGG. This has significant consequences for Dembski's claim about the fragility of protein sequences. Of course, structural redundancy is not just observed at the amino acid level.

    Proteins also have a high degree of structural or functional redundancy. Take cytochrome c, for example. Cytochrome c is a hemeprotein which is 100 amino acids long just like in the creationist example above. However, it has a massive degree of structural redundancy as seen in the species comparison below:

    Cyto-Seq.jpg

    As you can see in the image above, you have widely varying amino acid sequences yet each of these sequences result in cytochrome c. In fact, for all 100 unit amino acid sequences (approx. 10^130 possible combinations) 10^67 result in cytochrome c. So Dembski's claim that mutation destroys complex specified information is demonstrably false.

    Another example of this phenomenon is haemoglobin. There are over 250 different mutations in the haemoglobin protein which have been documented and yet the function of the protein is unaffected. That's 250 variations of a protein which is only 287 amino acids long in the first place.

    This idea is well-documented in the literature being featured even in some textbooks. Some references for those interested:

    Cytochromes c: Evolutionary, Structural and Physicochemical Aspects

    Protein folding and protein evolution: common folding nucleus in different subfamilies of c-type cytochromes?

    Structural and genetic analysis of the folding and function of T4 lysozyme

    OK, I think I've taken up enough of everyone's time, time to summarize:

    • Although Dembski's use of Kolmogorov complexity is the opposite of it's use in mainstream biology, the point is moot since functional and non-functional sequences can and do have the same Kolmogorov complexity.
    • Complex specified information only becomes relevant, even theoretically, if we restrict mutation types to indels and frameshift mutations. Since there are other types of mutation which do not operate in this way, the idea of CSI is fatally undermined.
    • Even if we consider point mutations, they have little impact on the functionality of proteins owing to the structural redundancy of both amino acids and proteins.
    • Mutations can create new CSI/CFSI through the acquisition of novel features such as the development of nylonase


    CSI is a house of cards argument that its own author doesn't even bother to defend anymore. It looks all science-y from a distance but once you start to prod it a little the entire argument crumbles and it does so completely.


  • Registered Users, Registered Users 2 Posts: 1,236 ✭✭✭jigglypuffstuff


    I think I hold a different understanding of that definition to you. I understand "supernatural" to refer to things that are "beyond scientific understanding or the laws of nature" in terms of them being beyond EVER being understood by science or the laws of nature.

    The way you have parsed the definition is to say "supernatural" means anything that is CURRENTLY outside our scientific understanding. So, for example, before we knew the neurological underpinnings of Epilepsy at the level of the brain.... Epilepsy was "supernatural" because it was outside CURRENT scientific understanding.

    And I do not think that is the right way to parse the definition of "supernatural" at all. "Supernatural" is about what is BEYOND EVER being understood using science, not what is CURRENTLY beyond being understood by science. Therefore Epilepsy was never "supernatural" even when we did not understand it.

    So to call the origins of our universe "supernatural" is to make an assumption that I do not think there is currently a basis to make. So I can but advise you do not make it.

    But is it? if we examine actual definitions of what supernatural is, versus what you posit it is, we can equally lend credence to what ive stated ....lets investigate

    Merriam Webster definition : of or relating to an order of existence beyond the visible observable universe; especially : of or relating to God or a god, demigod, spirit, or devil
    2
    a : departing from what is usual or normal especially so as to appear to transcend the laws of nature
    b : attributed to an invisible agent (such as a ghost or spirit)

    Cambridge : caused by forces that cannot be explained by science

    Now, I know that we have no explanation for these things first off, which you don't seem to agree is enough to consider it..but also remember that examining the phenomena in question that could possibly involve moving outside the boundaries of space & time, and with that let us consider Kuhn's words

    the reception of a new paradigm often necessitates a redefinition of the corresponding science. Some old problems may be relegated to another science or declared entirely "unscientific." [e.g. alchemy] Others that were previously non-existent or trivial may, with a new paradigm, become the very archetypes of significant scientific achievement. [e.g., tidology, the study of the tides] The normal-scientific tradition that emerges from a scientific revolution is not only incompatible but often actually in-commensurable with that which has gone before



    In the above sense, its somewhat plausible to see how the origins of the universe could be viewed as supernatural, as no existing paradigm can account for it, therefore we are left with no natural explanation. Considering the aforementioned its certainly possible that a scientific revolution may occur, which could possibly rewrite much of scientific consensus, thus redefining the supernatural as natural, however we will have to wait and see if that happens..in any event I do see the discrepancy and take what you've mentioned, so imo, you could interpret it whatever way you wish, depending on how you take the definition I guess


    It is hard to parse what a sentence like that means as quite often when I hear it and I delve further into it's meaning with the speaker..... it turns out what they mean by it is "Stop believing only what you find substantiation for, and open yourself up to believing stuff I have simply made up directly or second hand".

    And while YMMV I see nothing "limited" or "limiting" about only lending credence to claims which are presented to me with SOME modicum of argument, evidence, data or reasoning to lend them credence.

    I will reframe it to make it easier to understand then. My opinion is dont close yourself off to outside ideas because they dont match up to your beliefs (or lack of), rather take the "I dont know attitude".

    So are you saying there's nothing to suggest the actual existence of supernatural phenomena? I'm not accusing here I'm asking
    Well if I am also welcome to add mine, the answer is simply "I do not know, no one else seems to either, and I consider it an open question at this time".

    Certainly however the word "cause" gives me pause because causality is temporal, based on time, and time is an attribute that appears to have come into being "after" the big bang. So when we start talking about "causes" of the big bang or what happened "before" it......... I think we are entering into a realm of discourse outside normal human linguistics because our language is, for good reason, temporal based too.

    But whatever the answer turns out to be, assuming we ever find one, I think it will either not be a causal solution, or it will require a whole new model of causality that is independent of a temporal element. Either that or it is universe all the way down, each with a temporal element containing the next.

    But, as I said: I do not know, and no one else appears to either. We are, alas, entirely ignorant at this time.

    Correct me if I am wrong here, but are you saying that we will need to utilise a method that involves transcending the boundaries of time in order to get these answers?? again I'm asking not presuming
    And many users are past even bothering to reply to him or be trolled by him, which is why it is always welcome to have another like your good self enter the thread to lend some new life to the discussion.

    And I hope not too many users, and I hope you can forgive them, transfer their snidery on to you from him until such time as it is warranted to do so. But alas yes, there are those who will jump on any creationist (or similar) that comes into this thread as if they are just another head of the same snake.

    I trust you will find my own response above that, and you will return the decorum in the spirit it is offered.

    Indeed I do


    Well as I said above, we simply do not know if time was an element in the original creation or formation of our universe. It is just not knowledge we have. What we certainly do NOT have at this time is any model of causality without a temporal element, so really at this point we do not even have the LANGUAGE (aside, I suppose, for the language of mathematics) let alone the actual evidence and knowledge, to really talk about it outside the realm of navel gazing and guesswork.

    The only other thing I can say with any certainty after that is that WHATEVER the explanation for our universe is..... we at this time do not appear to have even a shred of a tiny modicum of argument, evidence, data or reasoning to suggest that the explanation lies in the workings of a non-human intelligent or intentional agent. Or a "god" if you will.

    To my knowledge anyway. If you ARE are of any such thing I have missed, you are more than invited to adumbrate it for me now. Clearly you have indicated in your most recent post you have a "faith" in such an intentional creation agent, but I would be interested if that is grounded in anything more substantive than the mere whim of faith?


    Well yes, I do have faith, or belief,. of that I can say you are correct, however it is a personal thing rather than affiliated with social structures. Also, as a person who actively strives to find answers, I am most open to new material from all walks of life...I read around various schools of thought, scientific, theological, philosophical etc, so I don't claim to have any answers, rather im just a person searching for them like anyone else...I can tell someone what I believe, and why I believe it, however I cannot provide scientific evidence.
    smacl wrote: »
    Be interested in hearing how you reconcile the notion of a creator with Taoist philosophy. While Taoism has a fair amount in common with pantheism, in terms of creation the general gist is from nothing (wuji) comes substance (taiji) which divides into two forms (liang yi or yin and yang), the four emblems, eight trigrams (pakua), sixty four hexagrams (as in the i ching), and the ten thousand things. So basically division and subdivision leading to exponentially increasing complexity, which isn't a bad stab at things for 4th century BCE. Certainly no creator and very little in common with Abrahamic creation myths.

    Now before we delve into any discussion about, Taoism, Tesla, electromagnetic frequencies, string theory, Taoist Philosophy, Neidan (Jing, Qi, Shen practives) Carl Jung, Vibrational frequencies, the esoteric, occult and all the other wondrous things we can speculate on...I do want to ask you...at what point did I mention anything about Abrahamic religions ?
    oldrnwisr wrote: »
    This is a complex topic and subject to a number of misconceptions but let's give it a go.

    Before we begin I want to repeat the two major caveats outlined previously by OscarBravo, namely, the only honest answer to what caused/preceded the big bang is that we don't know and that since time is a property of our current universe, talking about what happened before time existed is meaningless.

    However, we can posit possible scenarios for the cause of the big bang. In fact, the eventual fate of our current universe might give us a clue. The neatest possibility IMHO is the cyclical universe hypothesis outlined by Roger Penrose. It goes something like this.

    Right now we are in the stelliferous era of the universe, the age of stars. Once stars such as our sun begin to burn out, the universe will eventually only consist of white dwarfs, brown dwarfs and black holes. At this point we will enter the degenerate era. During this time white dwarfs will assimilate dark matter and proton decay will begin leaving only black holes. Then we enter the black hole era. Over time, the black holes themselves, due to Hawking radiation, will evaporate. At this point the universe will only consist of massless particles travelling at the speed of light. This dark era will stretch on for eternity, as the temperature of the universe cools to zero, and the density approaches zero. But if you are travelling at the speed of light, an eternity is no different from an instant. Time, as a scale of duration, becomes meaningless. This is the heat death of the universe. At this point, the infinite eternity of one universe is no different, scientifically speaking, from the singularity beginning of the next universe. It is possible, and plausible, that the universe may exist in an infinite series of cycles with the death of each universe being the big bang of the next.
    This isn't just a nice story. It is a coherent physical framework which fits within our current understanding of cosmology and quantum physics. Moreover, there has even been some preliminary experimental support for it:

    Concentric circles in WMAP data may provide evidence of violent pre-Big Bang activity

    On CCC-predicted concentric low-variance circles in the CMB sky

    Data gathered from the Wilkinson Microwave Anisotropy Probe (WMAP) suggests that there are variances in the cosmic background radiation (CMB) consistent with a cyclic conformal rescaling.

    For more basic explanations of this hypothesis you can read more here:

    The Five Ages of the Universe

    Heat death of the Universe

    Conformal cyclic cosmology

    There are also books on the subject, one dealing specifically with the hypothesis above:

    Cycles of Time: An Extraordinary New View of the Universe


    Like I said, at the beginning I like this hypothesis because it is a neat explanation. It covers all points while requiring few assumptions. It also has the benefit of some preliminary, very preliminary I hasten to add, experimental evidence.


    This is a huge topic and I think a primer on it might help your understanding immensely.

    The Hidden Reality: Parallel Universes and the Deep Laws of the Cosmos


    However, there are several important points to take away from all this.

    1. It is possible that the answer to the origin of the universe may be outside of our capacity to test, just like abiogenesis. We can propose theories and frameworks which fit our understanding of science but until we can go back in time and (in this case) outside our spacetime, we can't know which theory, if any, is correct. It's like discovering a murder victim after he's been cremated. You can hypothesise that he was stabbed or shot or smothered but there's no way to discern from the available evidence which theory is correct.

    2. The answer "I don't know" is perfectly valid in this, or any other context. The fact that person A has their claim utterly refuted by person B doesn't require person B to offer an alternate explanation to replace A's broken idea.

    3. God is a possible answer to the problem but one with no supporting evidence. Our current understanding of physics is such that we don't need to invoke a god to complete the theory or balance the equation if you will. You can still invoke God to answer all the things that science doesn't understand but that's not a very sound strategy.

    Ill be the first to admit im not well versed in the realm of quantum physics, multiple universes and such, rather ive only begun to scratch the surface of such topics, so I will review the links, and continue wading my way through the vast body of literature..Thanks for the links :)

    As you can see above, im of the opinion that understanding such phenomena to the point that we can form a valid explanation is far beyond our grasp at present, and will require a scientific revolution of sorts
    J C wrote: »
    Thanks for the support. I see no reason on a plain reading of Genesis to think that the Garden of Eden was anything but what it says on the tin ... a paradise on Earth.

    It is both ... we are primarily made in the spiritual / intellectual image of God ... but He also took on our physical image when He incarnated on Earth, as Jesus Christ.

    It often happens in relation to animals and inanimate objects.

    I know all about this stuff ... but it always comes up short of its initial promise ... because it is not of God.

    I could give you one..., Biblical literacy is a phenomenon that is little more than a century old

    Bur JC, you've said he took on our image, that contradicts the point you tried to make doesnt it?

    In what sense? I have yet to understand how these things fall short?


  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    pone2012 wrote: »
    Now before we delve into any discussion about, Taoism, Tesla, electromagnetic frequencies, string theory, Taoist Philosophy, Neidan (Jing, Qi, Shen practives) Carl Jung, Vibrational frequencies, the esoteric, occult and all the other wondrous things we can speculate on...I do want to ask you...at what point did I mention anything about Abrahamic religions ?

    In your previous post you say;
    pone2012 wrote: »
    Let me propose something to you..perhaps when God created us in his image it isn't referring to our physical appearance.. But rather our consciousness... I'll elaborate if you need me to ?

    Fwiw I have a firm faith we were created

    Once you say when God created us as opposed to if god created us and follow this with the statement relating to your faith, this implies a belief in God (singular). In the context of this thread, I would take God (as opposed to a god or gods) to be the once favoured by the Abrahamic traditions. This is in stark contrast to Taoist beliefs which vary from non-theistic to polytheistic, but in no cases suggest that we were created by God (or anyone else for that matter).


  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    oldrnwisr wrote: »
    He, and you, are fractally wrong.

    :)


  • Registered Users, Registered Users 2 Posts: 14,615 ✭✭✭✭J C


    oldrnwisr wrote: »
    OK, before we begin let's clear something up. There's no such thing as "complex functional specified information". The concept originally outlined by Dembski is based on the idea of specified complexity which existed in biology before Dembski ever put pen to paper, as it were.
    Glad you accept that there is specified complexity in living organisms ... and, of course, it existed there before Dembski identified and described it.
    ... and the specified complexity of the genetic information in living organisms is also functional in that it produces functional systems and abilities that are functional for the organism concerned.
    oldrnwisr wrote: »
    Dembski's work is often quoted as complex specified information but adding the word functional into the mix doesn't help your case any, it's just a meaningless term.
    How is the word functional 'meaningless'? ... functional means that it has a useful function or induces/provides functionality.
    oldrnwisr wrote: »
    Apart from two references on a blog and a single forum post the only references on the internet to "complex functional specified information" come from you. Not even other "creation scientists" use the term CFSI. Your problem is that CSI has been so comprehensively torn apart not just on this thread but by a number of actual scientists that you feel that tossing the word functional into the mix is somehow going to negate the fatal flaws in CSI. It isn't.
    As complex specified information has no fatal flaws, the addition of the word functional is merely a refinement of the concept.:)
    oldrnwisr wrote: »
    Now, let's talk specified complexity, Kolmogorov complexity and functionality.

    We've already seen that Dembski uses low Kolmogorov complexity as the basis for his idea of complex specified information. However, his total ignorance of biology undermines the concept from the get go. As I've already described low Kolmogorov complexity allows for the information content of a message to be transmitted in an abbreviated form. So if you want to send the following 32 bit string:

    ABABABABABABABABABABABABABABABAB

    you can just send "AB 16 times" which can take up just 9 bits of information. Dembski's idea is that information with specified complexity i.e. something that is functionally useful for an organism would have a DNA sequence which has low Kolmogorov complexity. He further argues, just as you have done above that mutation increases Kolmogorov complexity at the cost of function. He, and you, are fractally wrong.

    Firstly, let's consider a single mutation in the above sequence:

    ABABABCBABABABABABABABABABABABAB

    Now, we have changed the sequence by just a single letter but we have significantly increased the Kolmogorov complexity. But what does this do to the function of the sequence? Well, in this hypothetical example, nothing because it's just a simplified example, but next let's look at a real example.

    On the short arm of chromosome 4 there exists a gene with the following structure:

    CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

    Now, using Dembski's argument this gene is an example of complex specified information since a) it has low Kolmogorov complexity and b) it has a specific function, i.e. it codes for the protein huntingtin. Dembski's idea is that a mutation in this gene would lead to increased Kolmogorov complexity. Does it? Well, as it turns out no. The structure above is an example of the gene sequence in a healthy adult. Now let's look at two mutated sequences:

    1.
    CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAG

    2.
    CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAGCAGCAGCAGCAG

    The healthy version of the gene contains repeats of the codon CAG with normally between 6 and 35 repeats. The first mutated example above contains 36 repeats while the second example contains 40 repeats. In the first example, the 36 repeats cause the huntingtin protein to stop working normally and it no longer interacts with other proteins as it normally would. In the second mutated example, a modified huntingtin protein is produced which fragments itself and draws other proteins into lumps forming neuronal intranuclear inclusions which causes the person with the mutated gene to develop Huntington's disease. So we have three examples above of DNA sequences with normal function, no function and harmful function. What about the Kolmogorov complexity. Well, since the sequence is composed of repeats of the same codon, the Kolmogorov complexity for all three sequences is exactly the same, contrary to what Dembski predicts.
    Your chosen example of a repeat mutation doesn't increase Kolmogorov complexity ... but had it been a point mutation it would. However, it really is a moot point how complex the gene is ... what really matters is it's specificity ... and how rapidly it loses functionality with changes to its specificity ... in the example you quote above, even though its Kolmogorov complexity didn't increase ... crucially its specificity declined ... and this parallelled its decline in functionalty ... to the point where its host developed clinical disease.
    It is even possible that a deleterious deletion will reduce the Kolmogorov complexity ... but either way, it's the specificity that is the issue ... and with it, the functionality.
    oldrnwisr wrote: »
    There are two more problems with Dembski's CSI idea, one of which we've already touched on and one we haven't.

    Firstly, mutation types. In post 2617 I explained why Dembski's CSI idea fails because he believes that mutation happens only through indels (insertions or deletions) of nucleotides or frameshift mutations. It doesn't and mutations like gene duplication or aneuploidy completely obviate Dembski's argument about increasing complexity destroying functionality. Furthermore, we have evidence of novel functionality being acquired through mutation contrary to what Dembski claims.
    Relative complexity isn't the point at issue at all ... non-living things like snowflakes have amazing levels of complexity ... but they lack specificity and functionality. The critical phenomenon that is the signature of intelligent input in the CFSI in living organisms (and anywhere else it is found) is the specificity (and not the complexity). Like I have said, it is even possible that a deleterious deletion will reduce the Kolmogorov complexity ... but either way it's the specificity that is affected ... and with it, the functionality.
    oldrnwisr wrote: »
    Emergence of nylon oligomer degradation enzymes in Pseudomonas aeruginosa PAO through experimental evolution.

    Evolution of a regulated operon in the laboratory


    Evolution of a new enzymatic function by recombination within a gene

    These are just 3 examples out of over 3000 papers which detail the acquisition of novel function through gene duplication or mutation types other than those considered by Dembski.
    These are examples of the quality of the pre-exsiting CFSI present within living organisms that they are able to intelligently produce novel abilities themselves ... its akin to a very sophisticated robot that can learn to produce novel things (an example of intelligent programming of intelligence into the robot) ... and not something spontaneously inherent in the physical/electrical systems in the robot.
    Human Beings are always doing novel things that vastly exceed the examples you cite ... and these are a product of their inherent intelligence ... which, in turn, is ultimately a product of the very sophisticated CFSI present in their genomes. In the case of Humans their intelligence is a step change above other organisms ... due to their spiritual natures ... but this exception is not germaine to the subject under discussion (their CFSI which is a physical and virtual phenomenon) is directly linked to their physical DNA programming.

    oldrnwisr wrote: »
    Now, secondly, for the big elephant in the room, redundancy. Dembski (and other creationists) argue the idea that a protein sequence needs to be a certain way, that if you change one letter out of a 100 amino acid sequence then you're going to **** everything up and nothing's going to work anymore. Trouble is he's dead wrong. Just to underscore this problem here's an excerpt of a creationist trying to prove design using Shannon information:

    "Complex specified information is a specified subset of Shannon information. That means that complex specified information is Shannon information of a specified nature, ie with meaning and/ or function, and with a specified complexity.

    Shannon's tells us that since there are 4 possible nucleotides, 4 = 2^2 = 2 bits of information per nucleotide. Also there are 64 different coding codons, 64 = 2^6 = 6 bits of information per amino acid, which, is the same as the three nucleotides it was translated from.

    Take that and for example a 100 amino acid long functioning protein- a protein that cannot tolerate any variation, which means it is tightly specified and just do the math 100 x 6 + 6 (stop) = 606 bits of specified information- minimum, to get that protein. That means CSI is present and design is strongly supported.

    Now if any sequence of those 100 amino acids can produce that protein then it isn't specified. IOW if every possible combo produced the same resulting protein, I would say that would put a hurt on the design inference."

    I have highlighted the portion of the post where the creationist argument unravels. He fails to take into account redundancy.
    Redundancy is an added feature of intelligent design (it wouldn't be a great design, if there wasn't some redundancy built in to cope with the inevitable damage that occurs from simply living). The redundancy is itself complex and specified and can be made dis-functional as changes are made to it as well. Of course there also has to be limits to redundancy, otherwise endless redundancy would become an efficiency issue ... and this is what we find ... we have two eyes ... not 22 eyes, for example!!
    oldrnwisr wrote: »
    Firstly, he mentions that there are 64 possible codons which, irrelevantly, is equal to 2^6. However, what he fails to mention is that these 64 codons produce just 20 amino acids as shown in the table below:




    There is a high degree of structural redundancy among codons such that, for example, arginine can be produced by any of the following combinations: CGT, CGC, CGA, CGG, AGA, AGG. This has significant consequences for Dembski's claim about the fragility of protein sequences. Of course, structural redundancy is not just observed at the amino acid level.

    Proteins also have a high degree of structural or functional redundancy. Take cytochrome c, for example. Cytochrome c is a hemeprotein which is 100 amino acids long just like in the creationist example above. However, it has a massive degree of structural redundancy as seen in the species comparison below:



    As you can see in the image above, you have widely varying amino acid sequences yet each of these sequences result in cytochrome c. In fact, for all 100 unit amino acid sequences (approx. 10^130 possible combinations) 10^67 result in cytochrome c. So Dembski's claim that mutation destroys complex specified information is demonstrably false.
    I think that you may be confusing redundancy, with critical amino acid sequences. Redundancy is a good thing and an example of further levels of intelligent design in organisms ... as such redundancy systems are themselves intelligently designed (i.e. have complex specificity) and integrate perfectly with the systems they are designed to replace, in the event of failure/mutation of the primary system.
    What Dembski was talking about are critical amino acid sequences within proteins and other biomolecules where any change in the sequence is observed to make the protein disfunctional.
    Equally, redundancy in codons for amino acids per se doesn't affect the fact that specificity is still vital, for example, take the codons for Leucine and Valine.
    The codons for Leucine are CTT, CTC, CTA, CTG, TTA, TTG
    while the codons for Valine are GTT, GTC, GTA, GTG
    As can be seen, just one change in the first nucleobase changes the codon from one for Leucine to one for Valine ... which, if it were in a critical aa sequence, could destroy the functionality of the protein, thereby possible leading to a lethal or semi-lethal issue for the organism concerned.

    So, even though there is considerable redundancy (as one would expect with an intelligently designed system) ... that redundancy is itself highly specified (and specificity is the hallmark of intelligent action/design).
    oldrnwisr wrote: »
    Another example of this phenomenon is haemoglobin. There are over 250 different mutations in the haemoglobin protein which have been documented and yet the function of the protein is unaffected. That's 250 variations of a protein which is only 287 amino acids long in the first place.

    This idea is well-documented in the literature being featured even in some textbooks. Some references for those interested:

    Cytochromes c: Evolutionary, Structural and Physicochemical Aspects

    Protein folding and protein evolution: common folding nucleus in different subfamilies of c-type cytochromes?

    Structural and genetic analysis of the folding and function of T4 lysozyme
    Again what you are doing is conflating (intelligently designed) redundancy with specificity and complexity. Like I have said, it is to be expected that an intelligently designed system will have built in redundancy ... but unfortunately for your argument, the redundancy is also highly specified (and thus also intelligently designed).
    oldrnwisr wrote: »
    OK, I think I've taken up enough of everyone's time, time to summarize:

    Although Dembski's use of Kolmogorov complexity is the opposite of it's use in mainstream biology, the point is moot since functional and non-functional sequences can and do have the same Kolmogorov complexity.
    Complex specified information only becomes relevant, even theoretically, if we restrict mutation types to indels and frameshift mutations. Since there are other types of mutation which do not operate in this way, the idea of CSI is fatally undermined.
    Only the 'strawman' argument that Kolmogorov complexity has any link to the functionality of biological systems is undermined. It is the 'S' (Specified) in CSI ... and not the 'C' (Complex) that is the critical hallmark of intelligent design. Many spontaneous designs (like fractals and snowflakes, are complex (sometimes highly complex) ... but because they lack specificity and functionaity they aren't products of intelligence.
    oldrnwisr wrote: »
    Even if we consider point mutations, they have little impact on the functionality of proteins owing to the structural redundancy of both amino acids and proteins.
    It all depends on where the point mutation is ... and if it affects down-stream systems to the point of impairing their functionality (and whether or not redundancy systems can neutralise the effects of the mutation).

    oldrnwisr wrote: »
    Mutations can create new CSI/CFSI through the acquisition of novel features such as the development of nylonase.
    You're confusing the intelligently designed capacity for intelligent action inherent in biological systems and organisms, with mutagenesis, which always degrades CFSI ... sometimes to the point of having lethal/semi-lethal results.
    If mutagenesis is such a wonderful source of new CSI/CFSI why do you think that all the scientific advice to people is to avoid mutagenesis and mutagenic agents?

    oldrnwisr wrote: »
    CSI is a house of cards argument that its own author doesn't even bother to defend anymore. It looks all science-y from a distance but once you start to prod it a little the entire argument crumbles and it does so completely.
    The identification and scientific description of CSI/CFSI is a major breakthrough in our understanding of the origins of life (on a par with the breakthough in our scientific understanding, that the identification and description of DNA itself was).
    The materialists within the scientific establishment will only countenance mechanisms that support the view that life was produced without God by natural processes.
    The fact that these materialistic processes have never been found, doesn't stop them rejecting evidence that lead to the opposite conclusion ... that the emergence of life was intelligently directed.:D


  • Advertisement
  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    J C wrote: »
    These are examples of the quality of the pre-exsiting CFSI present within living organisms that they are able to intelligently produce novel abilities themselves ... its akin to a very sophisticated robot that can learn to produce novel things (an example of intelligent programming of intelligence into the robot) ... and not something spontaneously inherent in the physical/electrical systems in the robot.

    Not sure how aware you are of cellular automata and self replicating automata, but we can observe some apparently complex problem solving behaviour without the need for complex programming, as illustrated in this article from Nature on slime mold solving a maze. Even in a system as simple as Conway's game of Life we see a vast array of forms appearing, evolving and stabilising or dying out all from about 100-150 lines of pretty simple code.



    And for self replicating automata you need neither computers nor life, as can be seen by this rather old video (but IMHO excellent) video;



  • Registered Users, Registered Users 2 Posts: 1,236 ✭✭✭jigglypuffstuff


    smacl wrote: »
    In your previous post you say;



    Once you say when God created us as opposed to if god created us and follow this with the statement relating to your faith, this implies a belief in God (singular). In the context of this thread, I would take God (as opposed to a god or gods) to be the once favoured by the Abrahamic traditions. This is in stark contrast to Taoist beliefs which vary from non-theistic to polytheistic, but in no cases suggest that we were created by God (or anyone else for that matter[/B]

    But smacl, that was a response to a statement JC made, not one that I came up with.. apologies for the when vs if...I was speaking in the context of the post being replied too...for the sake of simplicity lets keep it to created/designed (yes/no) and avoid the polytheistic, monotheistic, non theistic terminology...because that is in itself a huge field of discussion (Elohim, is it singular or plural? and so forth)

    Now in terms of Taoist Beliefs..The jade emperor, Pangu, Nuwa etc...these are amongst them (although not exclusively them), you are familiar yes?


  • Registered Users, Registered Users 2 Posts: 14,615 ✭✭✭✭J C


    smacl wrote: »
    Not sure how aware you are of cellular automata and self replicating automata, but we can observe some apparently complex problem solving behaviour without the need for complex programming, as illustrated in this article from Nature on slime mold solving a maze. Even in a system as simple as Conway's game of Life we see a vast array of forms appearing, evolving and stabilising or dying out all from about 100-150 lines of pretty simple code.



    And for self replicating automata you need neither computers nor life, as can be seen by this rather old video (but IMHO excellent) video;

    Yes indeed, when there is an intelligent input all these examples of complex specificity (and much more) are possible ... without an intelligent input they are all impossible.


  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    pone2012 wrote: »
    The jade emperor, Pangu, Nuwa etc...these are amongst them (although not exclusively them), you are familiar yes?

    Yep, but certainly not as creators, and as gods among a rather extensive pantheon. The gods in Taoism got assimilated into it from folk mythology and are in no way central to it in the way they would be to religion like Christianity. Very many Taoists don't worship them at all, being philosophical rather than religious Taoists, and if you read Laozi you won't find references to the supernatural dealing as it does primarily with the natural order of things.


  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    J C wrote: »
    Yes indeed, when there is an intelligent input all these examples of complex specificity (and much more) are possible ... without an intelligent input they are all impossible.

    Not really. If you take Conway's came of life for example and throw in random input it will regularly evolve to complex output with repeating patterns. Most of the time it will either arrive at a static state or die out entirely, but regularly this is not the case and we get artefacts such as gliders. If you allow the masses of random input and time span that a growing universe has to offer, this type of evolved complexity is inevitable for such as system. The notion that complexity can't evolve from chaos seems specious on that basis. If you take the actual observed behaviour of very simple organisms, such as the slime linked in my previous post, when placed in a constrained environment you see similarly complex behaviour ensuing with no high level input / programming involved.


  • Advertisement
  • Registered Users, Registered Users 2 Posts: 1,236 ✭✭✭jigglypuffstuff


    smacl wrote: »
    Yep, but certainly not as creators, and as gods among a rather extensive pantheon. The gods in Taoism got assimilated into it from folk mythology and are in no way central to it in the way they would be to religion like Christianity. Very many Taoists don't worship them at all, being philosophical rather than religious Taoists, and if you read Laozi you won't find references to the supernatural dealing as it does primarily with the natural order of things.

    Thats not entirley true smacl, very many dont yes, but also very many do...and as I can see you have familiarity with the concepts, you of all people should know that the practices (neidan etc) that have Taoist underpinnings are steeped in shamanic, spiritual, esoteric, occult and all sorts..... to say taosim doesnt deal with the supernatural isnt a fair lens to cast over it.....

    The Valley Spirit never dies
    It is named the Mysterious Female.
    And the doorway of the Mysterious Female
    Is the base from which Heaven and Earth sprang.
    It is there within us all the while;
    Draw upon it as you will; it never runs dry.

    That doesnt sound supernatural to you? not even a little bit?


  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    pone2012 wrote: »
    Thats not entirley true smacl, very many dont yes, but also very many do...and as I can see you have familiarity with the concepts, you of all people should know that the practices (neidan etc) that have Taoist underpinnings are steeped in shamanic, spiritual, esoteric, occult and all sorts..... to say taosim doesnt deal with the supernatural isnt a fair lens to cast over it.....

    The Valley Spirit never dies
    It is named the Mysterious Female.
    And the doorway of the Mysterious Female
    Is the base from which Heaven and Earth sprang.
    It is there within us all the while;
    Draw upon it as you will; it never runs dry.

    That doesnt sound supernatural to you? not even a little bit?

    No shortage of woo (as well as wu) in Taoism for sure, but still nothing comparable to creationism. Much of Chinese internal alchemy is dubious in the extreme, and best filed alongside homeopathy, rubbing crystals, and pretending that there are angels watching over you. At the same time, some of it can have significant health benefits (e.g. certain qigong sets, taijiquan, etc..) particularly as a regime in preventative health. You also have to be wary of how you translate things, e.g. the qi referred to in qigong and underpinning neidan has no less than 23 definitions in the great dictionary of chinese characters. See A brief history of qi for more on this. The mysterious female in the above verse is a reference to yin, or essential femaleness, darkness, softness and fluidity. It is not a reference to any given female person or deity, though that is how it would read to many.


  • Registered Users, Registered Users 2 Posts: 14,615 ✭✭✭✭J C


    smacl wrote: »
    Not really. If you take Conway's came of life for example and throw in random input it will regularly evolve to complex output with repeating patterns. Most of the time it will either arrive at a static state or die out entirely, but regularly this is not the case and we get artefacts such as gliders. If you allow the masses of random input and time span that a growing universe has to offer, this type of evolved complexity is inevitable for such as system. The notion that complexity can't evolve from chaos seems specious on that basis.
    This uses a pre-existing intelligently designed computer and an intelligently designed programme.

    Of course complexity can emerge from chaos ... the issue is that specified functionality doesn't emerge without an intelligent input ... and that is why specified functionality is the hallark of intelligent design ... and not complexity.


  • Registered Users, Registered Users 2 Posts: 1,236 ✭✭✭jigglypuffstuff


    smacl wrote: »
    No shortage of woo (as well as wu) in Taoism for sure, but still nothing comparable to creationism. Much of Chinese internal alchemy is dubious in the extreme, and best filed alongside homeopathy, rubbing crystals, and pretending that there are angels watching over you. At the same time, some of it can have significant health benefits (e.g. certain qigong sets, taijiquan, etc..) particularly as a regime in preventative health. You also have to be wary of how you translate things, e.g. the qi referred to in qigong and underpinning neidan has no less than 23 definitions in the great dictionary of chinese characters. See A brief history of qi for more on this. The mysterious female in the above verse is a reference to yin, or essential femaleness, darkness, softness and fluidity. It is not a reference to any given female person or deity, though that is how it would read to many.


    With all do respect, my understanding of the Taoist perspective is far beyond you needing to provide a definition of yin, yang or Qi. Im quite aware of the properties of Yin and Yang, their nature, relationship to scientific phenomena and much more....This is not something I started studying yesterday (Unlike Quantum Physics, in which case school me).

    Id add passive to that list of yin properties, and lunar too, and magnetism, mitochondria and so on..Theres a long, long list. And yet you believe that this is not a reference to a diety...now I am not saying it is, Im saying it could be..however you are saying it isnt, in which case I ask why is that?

    In terms of you referring to Neidan as dubious, have you actually engaged in such activities to warrant that ? What makes you so sure


  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    pone2012 wrote: »
    With all do respect, my understanding of the Taoist perspective is far beyond you needing to provide a definition of yin, yang or Qi. Im quite aware of the properties of Yin and Yang, their nature, relationship to scientific phenomena and much more....This is not something I started studying yesterday (Unlike Quantum Physics, in which case school me).

    Id add passive to that list of yin properties, and lunar too, and magnetism, mitochondria and so on..Theres a long, long list. And yet you believe that this is not a reference to a diety...now I am not saying it is, Im saying it could be..however you are saying it isnt, in which case I ask why is that?

    If you think that yin and yang could be deities you need to revisit your Taoist literature as this is wildly off the mark. These are concepts, not physical things. From a Taoist perspective everything has yin and yang properties in varying amounts as everything derives from the tao and yin and yang are simply the first division of the tao.
    In terms of you referring to Neidan as dubious, have you actually engaged in such activities to warrant that ? What makes you so sure

    I've had many years of practise of various neigong and qigong sets in the past along with decades of taijiquan, so a bit, yes. The Chinese have long ascribed various magical properties to different gung practices. For example, the boxers in the boxer rebellion believed the exercise regime they performed made them impervious to bullets. Needless to say, it didn't pan out so well for them. You still see all sorts of snake oil peddled in much the same way, such as projecting qi to take out an opponent using empty force. Taoist sexual practises can also be pretty bizarre, such as attaching weights to your testicles to improve longevity, or eating ground up rhino horn as an aphrodisiac.

    You say you don't need a definition of qi. I'd be interested in hearing your definition of it.


  • Registered Users, Registered Users 2 Posts: 9,369 ✭✭✭nozzferrahhtoo


    pone2012 wrote: »
    But is it? if we examine actual definitions of what supernatural is, versus what you posit it is, we can equally lend credence to what ive stated

    Except you just did the exact opposite and what you present is perfectly consistent with my position. Ta for that.

    Even the first definition you offer puts things into the realm of "supernatural" that makes no sense to do so. For example there is highly likely to be planets outside the observable universe, just like there is INSIDE it.

    So by the definition you have cherry picked, a planet we can see is "natural" and a planet we can not yet see is "supernatural". That is just nonsense really. A planet is a planet is a planet, and I see no coherence in one being natural and one being supernatural just because of it's location in our universe.

    Your second definition conforms to what I said, not what you said, too. Despite you putting it in bold as if you thought it was supporting your case. The words "transcend the laws of nature" for example. We do not know that the origin of the universe does any such thing. We simply do not know. So once again your interpretation of the word means that basically anything we do not know or understand is "supernatural". Which as I said means things like "epilepsy" were once "supernatural" because we once did not understand it's causes.

    That is the kind of nonsense that comes of using a definition that misses the difference between "cannot (as in CURRENTLY) by explained by science" and "CANNOT be explained by science".

    The same is true of the "that cannot be explained by science" you offered. AGAIN here I think you make the same error I corrected before, which is that you are mistaking the wording as meaning it can not be understood by current science when I maintain that the meaning is it CANNOT be explained by science, as in it can NEVER be explained by science. In other words to call the origin of our universe "supernatural" you are asserting it can not be explained by science. Just because it has not YET been explained by science is no grounds to assert it NEVER CAN be.
    pone2012 wrote: »
    I will reframe it to make it easier to understand then.My opinion is dont close yourself off to outside ideas because they dont match up to your beliefs (or lack of), rather take the "I dont know attitude".

    But I am not seeing anyone here who has been "closing themselves to ideas" at all. I just see people who, while remaining open to new and different ideas, are not open to accepting any unsubstantiated notion that careens into consciousness or conversation.

    I am also not seeing anyone here who needs the advice on taking the "I dont know" attitude. Generally the people on this area of the forum are very cognizant of the limits of knowledge, be it their own or that of our species as a whole.

    Unfortunately, and I mean this as a general statement rather than directed at any individual, people.......... those with no arguments, evidence, data or reasoning to offer for their claims.......... merely push the narrative that people who do not buy their claims must be in some way closed to them. In other words they serve only to project their own failures onto some imagined failure, bias or agenda of the mark.
    pone2012 wrote: »
    So are you saying there's nothing to suggest the actual existence of supernatural phenomena? I'm not accusing here I'm asking

    I think what I "am saying" is clear. I am saying that we appear to exist, and we appear to exist in a universe. The explanation for all of that is something we currently do not have.

    But the level of argument, evidence, data and reasoning on offer to me at this time that suggests that the explanation, whatever it turns out to be, lies in the machinations and actions of a non-human intelligent and intentional agent...... is precisely zero.
    pone2012 wrote: »
    I can tell someone what I believe, and why I believe it, however I cannot provide scientific evidence.

    So far though it appears you have only told us WHAT you believe and not the "why" part, which is what I was asking. If the why is just faith, then that it at least an answer. But alas the limitations of a "just faith" result is that it precludes much of the possibilities for meaningful further discourse.

    Interesting though that YOU not I limited it to "scientific evidence" specifically. Quite a lot of people do that when talking to me, even though I did not make that limitation or stipulation myself. I write, and to you also wrote, the words "Any arguments, evidence, data or reasoning to lend the claim any credence". Which is quite a generalized and wide net for me to cast. But quite often people, just like you here, limit themselves specifically to scientific evidence, or act like, or outright claim, that it was I that made the limitation.

    I am open to any form of evidence offered coherently and cogently. I can then think consider it, evaluate it, and explain why I can accept or reject it.


  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    J C wrote: »
    This uses a pre-existing intelligently designed computer and an intelligently designed programme.

    Of course complexity can emerge from chaos ... the issue is that specified functionality doesn't emerge without an intelligent input ... and that is why specified functionality is the hallark of intelligent design ... and not complexity.

    So if the function we're trying to solve is for example navigating a maze, by your logic we need a higher order intelligence to do this. If that we're the case, the slime mold in my previously linked example should not be able to perform this very specific function, yet it does. Conway's game of life is merely a vastly simplified and accelerated example of how colonies of very simple organisms already react. Using time-lapse photography, You could watch something very similar play out on an agar filled petri dish in a lab or even a lichen covered rock on the seafront.


  • Registered Users, Registered Users 2 Posts: 9,779 ✭✭✭MrPudding


    J C wrote: »
    ... except I didn't do so ... I clearly indicated it was a quote ... and as it could be identified where the quote came from in 5 secs on google it I haven't presented the list as new and original and not derived from an existing source.

    Posting someone else's work without reference. That is plagiarism. You posted someone else's work, and you didn't reference it, therefore you committed plagerism. Subsequently, after being called out, saying anyone could google the reference is not referencing. You plagerised, plain and simple.
    J C wrote: »

    ... answering posts calling me unfounded names??

    Unfounded (adjective): lacking a sound basis.

    He gave at least two clear examples. There was or is nothing unfounded about the name. Also, I heard that lying makes baby jebus cry. Think about that JC.

    MrP


  • Registered Users, Registered Users 2 Posts: 436 ✭✭bren_mc


    J C wrote: »
    This uses a pre-existing intelligently designed computer and an intelligently designed programme.

    Of course complexity can emerge from chaos ... the issue is that specified functionality doesn't emerge without an intelligent input ... and that is why specified functionality is the hallark of intelligent design ... and not complexity.

    I thoroughly agree and must therefore conclude that what I see all around me must be complexity from chaos rather than "specified functionality"


  • Moderators, Society & Culture Moderators Posts: 24,476 Mod ✭✭✭✭robindch


    J C wrote: »
    ... except I didn't do so ... I clearly indicated it was a quote ... and as it could be identified where the quote came from in 5 secs on google it [...]
    Not sure what copying somebody else's work without attribution is called in the private and peculiar world of creationists, but out here in the real world, it's called plagiarism and you've been called out before on it.


  • Advertisement
  • Registered Users, Registered Users 2 Posts: 14,615 ✭✭✭✭J C


    robindch wrote: »
    Not sure what copying somebody else's work without attribution is called in the private and peculiar world of creationists, but out here in the real world, it's called plagiarism and you've been called out before on it.
    Have you got anything to add to the topic under discussion on this thread, Robin, other than nit-picking over how to attribute quotes from somebody else ...
    ... it apparently isn't sufficient to indicate something is a quote ... and let anybody who is interested, google where the quote came from, we have to give it's seed, breed and generation as well!!!

    ... and BTW plagarism is taking "(the work or an idea of someone else) and passing it off as one's own".:eek:

    How did I pass the list off as my own ?

    ... are you now accusing me of quoting myself?:(

    http://www.boards.ie/vbulletin/showpost.php?p=103807716&postcount=2569


  • Registered Users, Registered Users 2, Paid Member Posts: 31,668 ✭✭✭✭looksee


    Mod: JC, cease and desist now with this wittering about plagiarism. The others including Robin are correct, you need to quote your sources. Now that particular topic is closed, can we get on with the specious nonsense please.


  • Moderators, Society & Culture Moderators, Paid Member Posts: 16,343 Mod ✭✭✭✭smacl


    looksee wrote: »
    Can we get on with the specious nonsense please.

    Some days you just gotta love boards.ie :)


  • Registered Users, Registered Users 2 Posts: 9,779 ✭✭✭MrPudding


    smacl wrote: »
    Some days you just gotta love boards.ie :)

    Yes. That's quite enough facts, let get back to the creationist nonsense.

    MrP


  • Registered Users, Registered Users 2 Posts: 14,615 ✭✭✭✭J C


    MrPudding wrote: »
    Yes. That's quite enough facts, let get back to the creationist nonsense.

    MrP
    The 'specious nonsense' in the title of this thread actually refers to Evolution ... and a book written showing up many of the invalidities and logical defects in the Theory of Evolution ... and all its many parts.:)

    https://www.amazon.co.uk/Origin-Specious-Nonsense-John-May/dp/1907179712

    ... but why let this fact stand in the way of your overwhelming need to have a go at creationism, every time you get your hands on a keyboard? :eek:


  • Registered Users, Registered Users 2 Posts: 14,615 ✭✭✭✭J C


    wrote:
    Originally Posted by looksee
    ... you need to quote your sources. Now that particular topic is closed, can we get on with the specious nonsense please.
    OK looksee ... as the 'spacious nonsense' refers to evolution and I have been accused of not fully referencing my quotes ... I'll crack off, specially for you ... addressing both points ... with fully referenced quotes on the 'specious nonsense' that is evolution :):D

    "The number of intermediate varieties which have formerly existed on
    earth must be truly enormous. Why then is not every geological
    formation and every stratum full of such intermediate links? Geology
    assuredly does not reveal any such finely graduated organic chain; and
    this, perhaps, is the most obvious and gravest objection which can be
    urged against my theory." - Charles Darwin 1902 edition.

    “…I am quite conscious that my speculations run beyond the bounds of
    true science….It is a mere rag of an hypothesis with as many flaw &
    holes as sound parts.” Charles Darwin to Asa Gray, cited by Adrian
    Desmond and James Moore, Darwin, (New York: W.W. Norton and
    Company, 1991) pp. 456, 475.

    “Nowhere was Darwin able to point to one bona fide case of natural
    selection having actually generated evolutionary change in
    nature….Ultimately, the Darwinian theory of evolution is no more nor
    less than the great cosmogenic myth of the twentieth century.” Michael
    Denton, Evolution: A Theory in Crises (Bethesda, Maryland: Adler &
    Adler, 1986) pp. 62, 358.

    “I believe that one day the Darwinian myth will be ranked the greatest
    deceit in the history of science.” Søren Løvtrup, Darwinism: The
    Refutation of a Myth (New York: Croom Helm, 1987), p. 422.

    “Scientists who go about teaching that evolution is a fact of life are great
    con-men, and the story they are telling may be the greatest hoax ever.
    In explaining evolution, we do not have one iota of fact.” Dr. T. N.
    Tahmisian Evolution and the Emperor's New Clothes by N.J. Mitchell
    (United Kingdom: Roydon Publications, 1983), title page.

    “And the salient fact is this: if by evolution we mean macroevolution (as
    we henceforth shall), then it can be said with the utmost rigor that the
    doctrine is totally bereft of scientific sanction. Now, to be sure, given the
    multitude of extravagant claims about evolution promulgated by
    evolutionists with an air of scientific infallibility, this may indeed sound
    strange. And yet the fact remains that there exists to this day not a shred
    of bona fide scientific evidence in support of the thesis that
    macroevolutionary transformations have ever occurred.” Wolfgang
    Smith, Teilhardism and the New Religion (Rockford., Ill.: Tan Books,
    1988), pp. 5-6. Dr. Smith, taught at MIT and UCLA.

    "Our theory of evolution has become . . one which cannot be refuted by
    any possible observations. Every conceivable observation can be fitted
    into it . . No one can think of ways in which to test it. Ideas wither without
    basis or based on a few laboratory experiments carried out in extremely
    simplified systems, have attained currency far beyond their validity. They
    have become part of an evolutionary dogma accepted by most of us as
    part of our training." L.C. Birch and *P. Ehrlich, Nature, April 22, 1967.

    "What is at stake is not the validity of the Darwinian theory itself, but of
    the approach to science that it has come to represent. The peculiar form
    of consensus the theory wields has produced a premature closure of
    inquiry in several branches of biology, and even if this is to be expected
    in `normal science,' such a dogmatic approach does not appear
    healthy." R. Brady, "Dogma and Doubt," Biological Journal of the
    Linnean Society, 17:79, 96 (1982)


  • Registered Users, Registered Users 2, Paid Member Posts: 31,668 ✭✭✭✭looksee


    Mod: You were asked to get back on topic, whether the specious nonsense refers to Evolution or Creationism is irrelevant. Your quoted references are also not especially relevant to the current conversation, the argument was about your unreferenced quote some pages back. Please do not comment on thread about mod actions, pm if necessary.


  • Posts: 25,874 ✭✭✭✭ [Deleted User]


    J C wrote: »
    The 'specious nonsense' in the title of this thread actually refers to Evolution ... and a book written showing up many of the invalidities and logical defects in the Theory of Evolution ... and all its many parts.:)
    It hasn't been about that book for a very very long time.

    utzTCyo.png

    What ever happened to the book and the author? Anyone ever follow it up?


  • Registered Users, Registered Users 2 Posts: 9,779 ✭✭✭MrPudding


    J C wrote: »
    The 'specious nonsense' in the title of this thread actually refers to Evolution ... and a book written showing up many of the invalidities and logical defects in the Theory of Evolution ... and all its many parts.:)

    https://www.amazon.co.uk/Origin-Specious-Nonsense-John-May/dp/1907179712

    ... but why let this fact stand in the way of your overwhelming need to have a go at creationism, every time you get your hands on a keyboard? :eek:

    It refers to a book, yes. A book that is full of nonsense. You think the specious nonsense is in relation to evolution, but that is the irony. It isn't. That particular book has been torn apart and shown to be absolute nonsense.

    How about you try to address some of the points that have been raised that you are ignoring? And while you are at it, try to do it without plagerising someone's else's nonsense.

    MrP


  • Advertisement
  • Moderators, Society & Culture Moderators Posts: 24,476 Mod ✭✭✭✭robindch


    MrPudding wrote: »
    It refers to a book, yes. A book that is full of nonsense. You think the specious nonsense is in relation to evolution, but that is the irony. It isn't. That particular book has been torn apart and shown to be absolute nonsense.
    I happened to attend the launch of that book in Buswell's Hotel in Dublin some years ago.

    On the one hand, I felt genuinely sorry for the deluded man who wrote the book and who happened to be there that evening - I've a faint memory there was a back story of family unhappines with the author and the book, the details of which escape me.

    On the plus side, the hotel was filled with the oddest collection of individuals it must ever have seen - not the least of which were the men who almost came to physical blows at one point during floor questions following the launch, and the creationist who attended the launch in a strech limo while dressed up in a gorilla costume and who sauntered in with two ladies, each one wearing a bright pink tee-shirt several sizes too small, and each one laden with the most enormous breasts.

    It was quite an evening, I have to say.


Advertisement
Advertisement