Advertisement
If you have a new account but are having problems posting or verifying your account, please email us on hello@boards.ie for help. Thanks :)
Hello all! Please ensure that you are posting a new thread or question in the appropriate forum. The Feedback forum is overwhelmed with questions that are having to be moved elsewhere. If you need help to verify your account contact hello@boards.ie
The Origin of Specious Nonsense. Twelve years on. Still going. Answer soon.
Comments
-
In general, living CFSI has relatively low Kolmogorov complexity due to the limited combinatorial space for useful biomolecules and the genetic CFSI that produces them.
Mutagenesis will certainly increase its Kolmogorov complexity but at a very high cost in functionality and specificity ... rapidly reaching the point of complete disfunctionality and death.
OK, before we begin let's clear something up. There's no such thing as "complex functional specified information". The concept originally outlined by Dembski is based on the idea of specified complexity which existed in biology before Dembski ever put pen to paper, as it were. Dembski's work is often quoted as complex specified information but adding the word functional into the mix doesn't help your case any, it's just a meaningless term. Apart from two references on a blog and a single forum post the only references on the internet to "complex functional specified information" come from you. Not even other "creation scientists" use the term CFSI. Your problem is that CSI has been so comprehensively torn apart not just on this thread but by a number of actual scientists that you feel that tossing the word functional into the mix is somehow going to negate the fatal flaws in CSI. It isn't.
Now, let's talk specified complexity, Kolmogorov complexity and functionality.
We've already seen that Dembski uses low Kolmogorov complexity as the basis for his idea of complex specified information. However, his total ignorance of biology undermines the concept from the get go. As I've already described low Kolmogorov complexity allows for the information content of a message to be transmitted in an abbreviated form. So if you want to send the following 32 bit string:
ABABABABABABABABABABABABABABABAB
you can just send "AB 16 times" which can take up just 9 bits of information. Dembski's idea is that information with specified complexity i.e. something that is functionally useful for an organism would have a DNA sequence which has low Kolmogorov complexity. He further argues, just as you have done above that mutation increases Kolmogorov complexity at the cost of function. He, and you, are fractally wrong.
Firstly, let's consider a single mutation in the above sequence:
ABABABCBABABABABABABABABABABABAB
Now, we have changed the sequence by just a single letter but we have significantly increased the Kolmogorov complexity. But what does this do to the function of the sequence? Well, in this hypothetical example, nothing because it's just a simplified example, but next let's look at a real example.
On the short arm of chromosome 4 there exists a gene with the following structure:
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
Now, using Dembski's argument this gene is an example of complex specified information since a) it has low Kolmogorov complexity and b) it has a specific function, i.e. it codes for the protein huntingtin. Dembski's idea is that a mutation in this gene would lead to increased Kolmogorov complexity. Does it? Well, as it turns out no. The structure above is an example of the gene sequence in a healthy adult. Now let's look at two mutated sequences:
1.
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAG
2.
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGACAGCAGCAGCAGCAGCAGCAGCAGCAG
The healthy version of the gene contains repeats of the codon CAG with normally between 6 and 35 repeats. The first mutated example above contains 36 repeats while the second example contains 40 repeats. In the first example, the 36 repeats cause the huntingtin protein to stop working normally and it no longer interacts with other proteins as it normally would. In the second mutated example, a modified huntingtin protein is produced which fragments itself and draws other proteins into lumps forming neuronal intranuclear inclusions which causes the person with the mutated gene to develop Huntington's disease. So we have three examples above of DNA sequences with normal function, no function and harmful function. What about the Kolmogorov complexity. Well, since the sequence is composed of repeats of the same codon, the Kolmogorov complexity for all three sequences is exactly the same, contrary to what Dembski predicts.
There are two more problems with Dembski's CSI idea, one of which we've already touched on and one we haven't.
Firstly, mutation types. In post 2617 I explained why Dembski's CSI idea fails because he believes that mutation happens only through indels (insertions or deletions) of nucleotides or frameshift mutations. It doesn't and mutations like gene duplication or aneuploidy completely obviate Dembski's argument about increasing complexity destroying functionality. Furthermore, we have evidence of novel functionality being acquired through mutation contrary to what Dembski claims.
Emergence of nylon oligomer degradation enzymes in Pseudomonas aeruginosa PAO through experimental evolution.
Evolution of a regulated operon in the laboratory
Evolution of a new enzymatic function by recombination within a gene
These are just 3 examples out of over 3000 papers which detail the acquisition of novel function through gene duplication or mutation types other than those considered by Dembski.
Now, secondly, for the big elephant in the room, redundancy. Dembski (and other creationists) argue the idea that a protein sequence needs to be a certain way, that if you change one letter out of a 100 amino acid sequence then you're going to **** everything up and nothing's going to work anymore. Trouble is he's dead wrong. Just to underscore this problem here's an excerpt of a creationist trying to prove design using Shannon information:
"Complex specified information is a specified subset of Shannon information. That means that complex specified information is Shannon information of a specified nature, ie with meaning and/ or function, and with a specified complexity.
Shannon's tells us that since there are 4 possible nucleotides, 4 = 2^2 = 2 bits of information per nucleotide. Also there are 64 different coding codons, 64 = 2^6 = 6 bits of information per amino acid, which, is the same as the three nucleotides it was translated from.
Take that and for example a 100 amino acid long functioning protein- a protein that cannot tolerate any variation, which means it is tightly specified and just do the math 100 x 6 + 6 (stop) = 606 bits of specified information- minimum, to get that protein. That means CSI is present and design is strongly supported.
Now if any sequence of those 100 amino acids can produce that protein then it isn't specified. IOW if every possible combo produced the same resulting protein, I would say that would put a hurt on the design inference."
I have highlighted the portion of the post where the creationist argument unravels. He fails to take into account redundancy.
Firstly, he mentions that there are 64 possible codons which, irrelevantly, is equal to 2^6. However, what he fails to mention is that these 64 codons produce just 20 amino acids as shown in the table below:
There is a high degree of structural redundancy among codons such that, for example, arginine can be produced by any of the following combinations: CGT, CGC, CGA, CGG, AGA, AGG. This has significant consequences for Dembski's claim about the fragility of protein sequences. Of course, structural redundancy is not just observed at the amino acid level.
Proteins also have a high degree of structural or functional redundancy. Take cytochrome c, for example. Cytochrome c is a hemeprotein which is 100 amino acids long just like in the creationist example above. However, it has a massive degree of structural redundancy as seen in the species comparison below:
As you can see in the image above, you have widely varying amino acid sequences yet each of these sequences result in cytochrome c. In fact, for all 100 unit amino acid sequences (approx. 10^130 possible combinations) 10^67 result in cytochrome c. So Dembski's claim that mutation destroys complex specified information is demonstrably false.
Another example of this phenomenon is haemoglobin. There are over 250 different mutations in the haemoglobin protein which have been documented and yet the function of the protein is unaffected. That's 250 variations of a protein which is only 287 amino acids long in the first place.
This idea is well-documented in the literature being featured even in some textbooks. Some references for those interested:
Cytochromes c: Evolutionary, Structural and Physicochemical Aspects
Protein folding and protein evolution: common folding nucleus in different subfamilies of c-type cytochromes?
Structural and genetic analysis of the folding and function of T4 lysozyme
OK, I think I've taken up enough of everyone's time, time to summarize:- Although Dembski's use of Kolmogorov complexity is the opposite of it's use in mainstream biology, the point is moot since functional and non-functional sequences can and do have the same Kolmogorov complexity.
- Complex specified information only becomes relevant, even theoretically, if we restrict mutation types to indels and frameshift mutations. Since there are other types of mutation which do not operate in this way, the idea of CSI is fatally undermined.
- Even if we consider point mutations, they have little impact on the functionality of proteins owing to the structural redundancy of both amino acids and proteins.
- Mutations can create new CSI/CFSI through the acquisition of novel features such as the development of nylonase
CSI is a house of cards argument that its own author doesn't even bother to defend anymore. It looks all science-y from a distance but once you start to prod it a little the entire argument crumbles and it does so completely.0 -
nozzferrahhtoo wrote: »I think I hold a different understanding of that definition to you. I understand "supernatural" to refer to things that are "beyond scientific understanding or the laws of nature" in terms of them being beyond EVER being understood by science or the laws of nature.
The way you have parsed the definition is to say "supernatural" means anything that is CURRENTLY outside our scientific understanding. So, for example, before we knew the neurological underpinnings of Epilepsy at the level of the brain.... Epilepsy was "supernatural" because it was outside CURRENT scientific understanding.
And I do not think that is the right way to parse the definition of "supernatural" at all. "Supernatural" is about what is BEYOND EVER being understood using science, not what is CURRENTLY beyond being understood by science. Therefore Epilepsy was never "supernatural" even when we did not understand it.
So to call the origins of our universe "supernatural" is to make an assumption that I do not think there is currently a basis to make. So I can but advise you do not make it.
But is it? if we examine actual definitions of what supernatural is, versus what you posit it is, we can equally lend credence to what ive stated ....lets investigate
Merriam Webster definition : of or relating to an order of existence beyond the visible observable universe; especially : of or relating to God or a god, demigod, spirit, or devil
2
a : departing from what is usual or normal especially so as to appear to transcend the laws of nature
b : attributed to an invisible agent (such as a ghost or spirit)
Cambridge : caused by forces that cannot be explained by science
Now, I know that we have no explanation for these things first off, which you don't seem to agree is enough to consider it..but also remember that examining the phenomena in question that could possibly involve moving outside the boundaries of space & time, and with that let us consider Kuhn's words
the reception of a new paradigm often necessitates a redefinition of the corresponding science. Some old problems may be relegated to another science or declared entirely "unscientific." [e.g. alchemy] Others that were previously non-existent or trivial may, with a new paradigm, become the very archetypes of significant scientific achievement. [e.g., tidology, the study of the tides] The normal-scientific tradition that emerges from a scientific revolution is not only incompatible but often actually in-commensurable with that which has gone before
In the above sense, its somewhat plausible to see how the origins of the universe could be viewed as supernatural, as no existing paradigm can account for it, therefore we are left with no natural explanation. Considering the aforementioned its certainly possible that a scientific revolution may occur, which could possibly rewrite much of scientific consensus, thus redefining the supernatural as natural, however we will have to wait and see if that happens..in any event I do see the discrepancy and take what you've mentioned, so imo, you could interpret it whatever way you wish, depending on how you take the definition I guessnozzferrahhtoo wrote: »It is hard to parse what a sentence like that means as quite often when I hear it and I delve further into it's meaning with the speaker..... it turns out what they mean by it is "Stop believing only what you find substantiation for, and open yourself up to believing stuff I have simply made up directly or second hand".
And while YMMV I see nothing "limited" or "limiting" about only lending credence to claims which are presented to me with SOME modicum of argument, evidence, data or reasoning to lend them credence.
I will reframe it to make it easier to understand then. My opinion is dont close yourself off to outside ideas because they dont match up to your beliefs (or lack of), rather take the "I dont know attitude".
So are you saying there's nothing to suggest the actual existence of supernatural phenomena? I'm not accusing here I'm askingnozzferrahhtoo wrote: »Well if I am also welcome to add mine, the answer is simply "I do not know, no one else seems to either, and I consider it an open question at this time".
Certainly however the word "cause" gives me pause because causality is temporal, based on time, and time is an attribute that appears to have come into being "after" the big bang. So when we start talking about "causes" of the big bang or what happened "before" it......... I think we are entering into a realm of discourse outside normal human linguistics because our language is, for good reason, temporal based too.
But whatever the answer turns out to be, assuming we ever find one, I think it will either not be a causal solution, or it will require a whole new model of causality that is independent of a temporal element. Either that or it is universe all the way down, each with a temporal element containing the next.
But, as I said: I do not know, and no one else appears to either. We are, alas, entirely ignorant at this time.
Correct me if I am wrong here, but are you saying that we will need to utilise a method that involves transcending the boundaries of time in order to get these answers?? again I'm asking not presumingnozzferrahhtoo wrote: »And many users are past even bothering to reply to him or be trolled by him, which is why it is always welcome to have another like your good self enter the thread to lend some new life to the discussion.
And I hope not too many users, and I hope you can forgive them, transfer their snidery on to you from him until such time as it is warranted to do so. But alas yes, there are those who will jump on any creationist (or similar) that comes into this thread as if they are just another head of the same snake.
I trust you will find my own response above that, and you will return the decorum in the spirit it is offered.
Indeed I donozzferrahhtoo wrote: »Well as I said above, we simply do not know if time was an element in the original creation or formation of our universe. It is just not knowledge we have. What we certainly do NOT have at this time is any model of causality without a temporal element, so really at this point we do not even have the LANGUAGE (aside, I suppose, for the language of mathematics) let alone the actual evidence and knowledge, to really talk about it outside the realm of navel gazing and guesswork.
The only other thing I can say with any certainty after that is that WHATEVER the explanation for our universe is..... we at this time do not appear to have even a shred of a tiny modicum of argument, evidence, data or reasoning to suggest that the explanation lies in the workings of a non-human intelligent or intentional agent. Or a "god" if you will.
To my knowledge anyway. If you ARE are of any such thing I have missed, you are more than invited to adumbrate it for me now. Clearly you have indicated in your most recent post you have a "faith" in such an intentional creation agent, but I would be interested if that is grounded in anything more substantive than the mere whim of faith?
Well yes, I do have faith, or belief,. of that I can say you are correct, however it is a personal thing rather than affiliated with social structures. Also, as a person who actively strives to find answers, I am most open to new material from all walks of life...I read around various schools of thought, scientific, theological, philosophical etc, so I don't claim to have any answers, rather im just a person searching for them like anyone else...I can tell someone what I believe, and why I believe it, however I cannot provide scientific evidence.Be interested in hearing how you reconcile the notion of a creator with Taoist philosophy. While Taoism has a fair amount in common with pantheism, in terms of creation the general gist is from nothing (wuji) comes substance (taiji) which divides into two forms (liang yi or yin and yang), the four emblems, eight trigrams (pakua), sixty four hexagrams (as in the i ching), and the ten thousand things. So basically division and subdivision leading to exponentially increasing complexity, which isn't a bad stab at things for 4th century BCE. Certainly no creator and very little in common with Abrahamic creation myths.
Now before we delve into any discussion about, Taoism, Tesla, electromagnetic frequencies, string theory, Taoist Philosophy, Neidan (Jing, Qi, Shen practives) Carl Jung, Vibrational frequencies, the esoteric, occult and all the other wondrous things we can speculate on...I do want to ask you...at what point did I mention anything about Abrahamic religions ?This is a complex topic and subject to a number of misconceptions but let's give it a go.
Before we begin I want to repeat the two major caveats outlined previously by OscarBravo, namely, the only honest answer to what caused/preceded the big bang is that we don't know and that since time is a property of our current universe, talking about what happened before time existed is meaningless.
However, we can posit possible scenarios for the cause of the big bang. In fact, the eventual fate of our current universe might give us a clue. The neatest possibility IMHO is the cyclical universe hypothesis outlined by Roger Penrose. It goes something like this.
Right now we are in the stelliferous era of the universe, the age of stars. Once stars such as our sun begin to burn out, the universe will eventually only consist of white dwarfs, brown dwarfs and black holes. At this point we will enter the degenerate era. During this time white dwarfs will assimilate dark matter and proton decay will begin leaving only black holes. Then we enter the black hole era. Over time, the black holes themselves, due to Hawking radiation, will evaporate. At this point the universe will only consist of massless particles travelling at the speed of light. This dark era will stretch on for eternity, as the temperature of the universe cools to zero, and the density approaches zero. But if you are travelling at the speed of light, an eternity is no different from an instant. Time, as a scale of duration, becomes meaningless. This is the heat death of the universe. At this point, the infinite eternity of one universe is no different, scientifically speaking, from the singularity beginning of the next universe. It is possible, and plausible, that the universe may exist in an infinite series of cycles with the death of each universe being the big bang of the next.
This isn't just a nice story. It is a coherent physical framework which fits within our current understanding of cosmology and quantum physics. Moreover, there has even been some preliminary experimental support for it:
Concentric circles in WMAP data may provide evidence of violent pre-Big Bang activity
On CCC-predicted concentric low-variance circles in the CMB sky
Data gathered from the Wilkinson Microwave Anisotropy Probe (WMAP) suggests that there are variances in the cosmic background radiation (CMB) consistent with a cyclic conformal rescaling.
For more basic explanations of this hypothesis you can read more here:
The Five Ages of the Universe
Heat death of the Universe
Conformal cyclic cosmology
There are also books on the subject, one dealing specifically with the hypothesis above:
Cycles of Time: An Extraordinary New View of the Universe
Like I said, at the beginning I like this hypothesis because it is a neat explanation. It covers all points while requiring few assumptions. It also has the benefit of some preliminary, very preliminary I hasten to add, experimental evidence.
This is a huge topic and I think a primer on it might help your understanding immensely.
The Hidden Reality: Parallel Universes and the Deep Laws of the Cosmos
However, there are several important points to take away from all this.
1. It is possible that the answer to the origin of the universe may be outside of our capacity to test, just like abiogenesis. We can propose theories and frameworks which fit our understanding of science but until we can go back in time and (in this case) outside our spacetime, we can't know which theory, if any, is correct. It's like discovering a murder victim after he's been cremated. You can hypothesise that he was stabbed or shot or smothered but there's no way to discern from the available evidence which theory is correct.
2. The answer "I don't know" is perfectly valid in this, or any other context. The fact that person A has their claim utterly refuted by person B doesn't require person B to offer an alternate explanation to replace A's broken idea.
3. God is a possible answer to the problem but one with no supporting evidence. Our current understanding of physics is such that we don't need to invoke a god to complete the theory or balance the equation if you will. You can still invoke God to answer all the things that science doesn't understand but that's not a very sound strategy.
Ill be the first to admit im not well versed in the realm of quantum physics, multiple universes and such, rather ive only begun to scratch the surface of such topics, so I will review the links, and continue wading my way through the vast body of literature..Thanks for the links
As you can see above, im of the opinion that understanding such phenomena to the point that we can form a valid explanation is far beyond our grasp at present, and will require a scientific revolution of sortsThanks for the support. I see no reason on a plain reading of Genesis to think that the Garden of Eden was anything but what it says on the tin ... a paradise on Earth.
It is both ... we are primarily made in the spiritual / intellectual image of God ... but He also took on our physical image when He incarnated on Earth, as Jesus Christ.
It often happens in relation to animals and inanimate objects.
I know all about this stuff ... but it always comes up short of its initial promise ... because it is not of God.
I could give you one..., Biblical literacy is a phenomenon that is little more than a century old
Bur JC, you've said he took on our image, that contradicts the point you tried to make doesnt it?
In what sense? I have yet to understand how these things fall short?0 -
-
-
-
Advertisement
-
These are examples of the quality of the pre-exsiting CFSI present within living organisms that they are able to intelligently produce novel abilities themselves ... its akin to a very sophisticated robot that can learn to produce novel things (an example of intelligent programming of intelligence into the robot) ... and not something spontaneously inherent in the physical/electrical systems in the robot.
Not sure how aware you are of cellular automata and self replicating automata, but we can observe some apparently complex problem solving behaviour without the need for complex programming, as illustrated in this article from Nature on slime mold solving a maze. Even in a system as simple as Conway's game of Life we see a vast array of forms appearing, evolving and stabilising or dying out all from about 100-150 lines of pretty simple code.
And for self replicating automata you need neither computers nor life, as can be seen by this rather old video (but IMHO excellent) video;
0 -
-
Yes indeed, when there is an intelligent input all these examples of complex specificity (and much more) are possible ... without an intelligent input they are all impossible.Not sure how aware you are of cellular automata and self replicating automata, but we can observe some apparently complex problem solving behaviour without the need for complex programming, as illustrated in this article from Nature on slime mold solving a maze. Even in a system as simple as Conway's game of Life we see a vast array of forms appearing, evolving and stabilising or dying out all from about 100-150 lines of pretty simple code.
And for self replicating automata you need neither computers nor life, as can be seen by this rather old video (but IMHO excellent) video;0 -
-
-
Advertisement
-
-
-
-
-
-
-
-
-
-
-
Advertisement
-
-
-
-
-
-
OK looksee ... as the 'spacious nonsense' refers to evolution and I have been accused of not fully referencing my quotes ... I'll crack off, specially for you ... addressing both points ... with fully referenced quotes on the 'specious nonsense' that is evolutionOriginally Posted by looksee
... you need to quote your sources. Now that particular topic is closed, can we get on with the specious nonsense please.
"The number of intermediate varieties which have formerly existed on
earth must be truly enormous. Why then is not every geological
formation and every stratum full of such intermediate links? Geology
assuredly does not reveal any such finely graduated organic chain; and
this, perhaps, is the most obvious and gravest objection which can be
urged against my theory." - Charles Darwin 1902 edition.
“…I am quite conscious that my speculations run beyond the bounds of
true science….It is a mere rag of an hypothesis with as many flaw &
holes as sound parts.” Charles Darwin to Asa Gray, cited by Adrian
Desmond and James Moore, Darwin, (New York: W.W. Norton and
Company, 1991) pp. 456, 475.
“Nowhere was Darwin able to point to one bona fide case of natural
selection having actually generated evolutionary change in
nature….Ultimately, the Darwinian theory of evolution is no more nor
less than the great cosmogenic myth of the twentieth century.” Michael
Denton, Evolution: A Theory in Crises (Bethesda, Maryland: Adler &
Adler, 1986) pp. 62, 358.
“I believe that one day the Darwinian myth will be ranked the greatest
deceit in the history of science.” Søren Løvtrup, Darwinism: The
Refutation of a Myth (New York: Croom Helm, 1987), p. 422.
“Scientists who go about teaching that evolution is a fact of life are great
con-men, and the story they are telling may be the greatest hoax ever.
In explaining evolution, we do not have one iota of fact.” Dr. T. N.
Tahmisian Evolution and the Emperor's New Clothes by N.J. Mitchell
(United Kingdom: Roydon Publications, 1983), title page.
“And the salient fact is this: if by evolution we mean macroevolution (as
we henceforth shall), then it can be said with the utmost rigor that the
doctrine is totally bereft of scientific sanction. Now, to be sure, given the
multitude of extravagant claims about evolution promulgated by
evolutionists with an air of scientific infallibility, this may indeed sound
strange. And yet the fact remains that there exists to this day not a shred
of bona fide scientific evidence in support of the thesis that
macroevolutionary transformations have ever occurred.” Wolfgang
Smith, Teilhardism and the New Religion (Rockford., Ill.: Tan Books,
1988), pp. 5-6. Dr. Smith, taught at MIT and UCLA.
"Our theory of evolution has become . . one which cannot be refuted by
any possible observations. Every conceivable observation can be fitted
into it . . No one can think of ways in which to test it. Ideas wither without
basis or based on a few laboratory experiments carried out in extremely
simplified systems, have attained currency far beyond their validity. They
have become part of an evolutionary dogma accepted by most of us as
part of our training." L.C. Birch and *P. Ehrlich, Nature, April 22, 1967.
"What is at stake is not the validity of the Darwinian theory itself, but of
the approach to science that it has come to represent. The peculiar form
of consensus the theory wields has produced a premature closure of
inquiry in several branches of biology, and even if this is to be expected
in `normal science,' such a dogmatic approach does not appear
healthy." R. Brady, "Dogma and Doubt," Biological Journal of the
Linnean Society, 17:79, 96 (1982)0 -
-
It hasn't been about that book for a very very long time.The 'specious nonsense' in the title of this thread actually refers to Evolution ... and a book written showing up many of the invalidities and logical defects in the Theory of Evolution ... and all its many parts.:)
What ever happened to the book and the author? Anyone ever follow it up?0 -
-
Advertisement
-
https://www.youtube.com/watch?v=C2vgICfQawE
https://www.youtube.com/watch?v=2_9ohFWR0Vs
![[Deleted User]](/applications/dashboard/design/images/defaulticon.png)
Advertisement